ID: 944091480

View in Genome Browser
Species Human (GRCh38)
Location 2:195916769-195916791
Sequence AGTCATTTGAAGCCTGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944091476_944091480 6 Left 944091476 2:195916740-195916762 CCTTGCTACTCGGGAGGCTGAGG 0: 458
1: 103146
2: 288681
3: 226598
4: 124799
Right 944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG No data
944091474_944091480 14 Left 944091474 2:195916732-195916754 CCTGTAGTCCTTGCTACTCGGGA 0: 11
1: 1925
2: 65852
3: 194383
4: 272965
Right 944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944091480 Original CRISPR AGTCATTTGAAGCCTGGAGA CGG Intronic
No off target data available for this crispr