ID: 944094058

View in Genome Browser
Species Human (GRCh38)
Location 2:195946726-195946748
Sequence CCGGGTGAAGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944094058_944094068 12 Left 944094058 2:195946726-195946748 CCTTCCTCCTTCTCTTCACCCGG No data
Right 944094068 2:195946761-195946783 ACCCAGATGAGAAGCACAGGAGG No data
944094058_944094067 9 Left 944094058 2:195946726-195946748 CCTTCCTCCTTCTCTTCACCCGG No data
Right 944094067 2:195946758-195946780 CAAACCCAGATGAGAAGCACAGG No data
944094058_944094072 28 Left 944094058 2:195946726-195946748 CCTTCCTCCTTCTCTTCACCCGG No data
Right 944094072 2:195946777-195946799 CAGGAGGAGAGAAGTAGAGTGGG No data
944094058_944094071 27 Left 944094058 2:195946726-195946748 CCTTCCTCCTTCTCTTCACCCGG No data
Right 944094071 2:195946776-195946798 ACAGGAGGAGAGAAGTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944094058 Original CRISPR CCGGGTGAAGAGAAGGAGGA AGG (reversed) Intronic
No off target data available for this crispr