ID: 944100114

View in Genome Browser
Species Human (GRCh38)
Location 2:196016131-196016153
Sequence GTCTGTTAGACGATTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944100114_944100118 7 Left 944100114 2:196016131-196016153 CCTCCTGAAATCGTCTAACAGAC No data
Right 944100118 2:196016161-196016183 AGCATTTTATGGACAGTAGTAGG No data
944100114_944100116 -4 Left 944100114 2:196016131-196016153 CCTCCTGAAATCGTCTAACAGAC No data
Right 944100116 2:196016150-196016172 AGACCAAGTCTAGCATTTTATGG No data
944100114_944100119 13 Left 944100114 2:196016131-196016153 CCTCCTGAAATCGTCTAACAGAC No data
Right 944100119 2:196016167-196016189 TTATGGACAGTAGTAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944100114 Original CRISPR GTCTGTTAGACGATTTCAGG AGG (reversed) Intronic
No off target data available for this crispr