ID: 944101906

View in Genome Browser
Species Human (GRCh38)
Location 2:196036482-196036504
Sequence TATCCAGGAGTCTTCCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944101902_944101906 0 Left 944101902 2:196036459-196036481 CCCAAGGAATAGGCGATCCAGCA No data
Right 944101906 2:196036482-196036504 TATCCAGGAGTCTTCCCCCAAGG No data
944101898_944101906 24 Left 944101898 2:196036435-196036457 CCAAGTTCATGCAGTGTCCTACT No data
Right 944101906 2:196036482-196036504 TATCCAGGAGTCTTCCCCCAAGG No data
944101901_944101906 7 Left 944101901 2:196036452-196036474 CCTACTACCCAAGGAATAGGCGA No data
Right 944101906 2:196036482-196036504 TATCCAGGAGTCTTCCCCCAAGG No data
944101897_944101906 25 Left 944101897 2:196036434-196036456 CCCAAGTTCATGCAGTGTCCTAC No data
Right 944101906 2:196036482-196036504 TATCCAGGAGTCTTCCCCCAAGG No data
944101903_944101906 -1 Left 944101903 2:196036460-196036482 CCAAGGAATAGGCGATCCAGCAT No data
Right 944101906 2:196036482-196036504 TATCCAGGAGTCTTCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944101906 Original CRISPR TATCCAGGAGTCTTCCCCCA AGG Intronic
No off target data available for this crispr