ID: 944103747

View in Genome Browser
Species Human (GRCh38)
Location 2:196056533-196056555
Sequence TGTTGACTCCCATCCTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944103747_944103752 7 Left 944103747 2:196056533-196056555 CCAGAAGAGGATGGGAGTCAACA No data
Right 944103752 2:196056563-196056585 GAACAATCTTTCACCAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944103747 Original CRISPR TGTTGACTCCCATCCTCTTC TGG (reversed) Intronic
No off target data available for this crispr