ID: 944107983

View in Genome Browser
Species Human (GRCh38)
Location 2:196100115-196100137
Sequence GCACCATGTGATTTTCAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944107977_944107983 22 Left 944107977 2:196100070-196100092 CCTCTCACTTTCATTTAGAGAAA No data
Right 944107983 2:196100115-196100137 GCACCATGTGATTTTCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944107983 Original CRISPR GCACCATGTGATTTTCAAGG CGG Intergenic
No off target data available for this crispr