ID: 944110455

View in Genome Browser
Species Human (GRCh38)
Location 2:196125908-196125930
Sequence CTGGACACAATTGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944110455_944110457 -7 Left 944110455 2:196125908-196125930 CCAGTTTTTCCAATTGTGTCCAG No data
Right 944110457 2:196125924-196125946 TGTCCAGCTGCAAAATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944110455 Original CRISPR CTGGACACAATTGGAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr