ID: 944110457

View in Genome Browser
Species Human (GRCh38)
Location 2:196125924-196125946
Sequence TGTCCAGCTGCAAAATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944110455_944110457 -7 Left 944110455 2:196125908-196125930 CCAGTTTTTCCAATTGTGTCCAG No data
Right 944110457 2:196125924-196125946 TGTCCAGCTGCAAAATAAAGTGG No data
944110454_944110457 16 Left 944110454 2:196125885-196125907 CCGTCAAAGGCTTGTTAAAACAA No data
Right 944110457 2:196125924-196125946 TGTCCAGCTGCAAAATAAAGTGG No data
944110452_944110457 21 Left 944110452 2:196125880-196125902 CCTTCCCGTCAAAGGCTTGTTAA No data
Right 944110457 2:196125924-196125946 TGTCCAGCTGCAAAATAAAGTGG No data
944110453_944110457 17 Left 944110453 2:196125884-196125906 CCCGTCAAAGGCTTGTTAAAACA No data
Right 944110457 2:196125924-196125946 TGTCCAGCTGCAAAATAAAGTGG No data
944110451_944110457 22 Left 944110451 2:196125879-196125901 CCCTTCCCGTCAAAGGCTTGTTA No data
Right 944110457 2:196125924-196125946 TGTCCAGCTGCAAAATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944110457 Original CRISPR TGTCCAGCTGCAAAATAAAG TGG Intergenic
No off target data available for this crispr