ID: 944114245

View in Genome Browser
Species Human (GRCh38)
Location 2:196170958-196170980
Sequence CCGCGCGGGCCCGCCGCGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944114239_944114245 -5 Left 944114239 2:196170940-196170962 CCTTGCTGTGGAAGGGACCCGCG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 75
944114236_944114245 3 Left 944114236 2:196170932-196170954 CCGCGTGGCCTTGCTGTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 155
Right 944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944114245 Original CRISPR CCGCGCGGGCCCGCCGCGAA GGG Intronic
901500887 1:9652042-9652064 CCCCGTGGGCCCGCCGAGAGGGG + Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
906805600 1:48776649-48776671 CCCCGCGCGCCCCCCGCGACTGG - Exonic
910892302 1:92030319-92030341 CCGCGCGGGCCTGGCGGGAGCGG + Intronic
1066548198 10:36524423-36524445 CCGCTGGGGCCCGCCAGGAATGG + Intergenic
1072700967 10:97641023-97641045 CCGCTCAGGCCCACCGCGAGCGG + Exonic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1081873036 11:46391836-46391858 CGGCGCGGCCCCGCCACGATTGG - Intergenic
1083782327 11:64924934-64924956 CCGAGCGGAACCGCTGCGAAGGG + Exonic
1083800039 11:65041345-65041367 CCGAGCGCGCCCAGCGCGAAAGG + Exonic
1087172702 11:95067119-95067141 CCGCGTGGGGACGCCGGGAAAGG - Intergenic
1092143716 12:6200738-6200760 CCGGGCGGGACGGCCGCGACGGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1115761734 14:36582889-36582911 CCCCGCGGGAGCGCCGGGAAGGG + Intergenic
1124251219 15:28107427-28107449 CAGCGCGGGTCCGCTGAGAATGG + Intergenic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1139451236 16:67029370-67029392 CCGCGCCGGCCGGCCGCGCTCGG - Exonic
1142136994 16:88456028-88456050 CAGCGCGGGGGCGCCGCGACTGG + Intronic
1147761214 17:42798694-42798716 CCGCGCGGCGGCACCGCGAAGGG - Exonic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1151559223 17:74861738-74861760 CCGCGAGGGCCCGCCCCGCCGGG + Intergenic
1152245560 17:79183077-79183099 CCGCGCTCGGCCGCCGCGCAGGG + Intronic
1153959926 18:10132004-10132026 CCGCGCAGGGCAGCCGCGCAGGG + Intergenic
1158648884 18:59269356-59269378 CTGCCCGGGCCCGCCCCGAGGGG + Exonic
1159241751 18:65750970-65750992 CCGCTCGGGCCCGCCCGGCACGG - Exonic
1160909842 19:1469378-1469400 CAGCGCGGGCCGGCCGCGGCGGG - Exonic
1161153468 19:2721124-2721146 CCGGCCGGGCCCGGCGGGAAGGG + Intronic
1161314927 19:3613315-3613337 CCGCCCGGGCCCTCCTCGGAGGG - Exonic
1167075225 19:47244344-47244366 CCGCGCGGCCGGGCCGGGAAAGG - Intergenic
927965499 2:27265155-27265177 CCGCGCGGGCTGCCCGGGAAGGG - Intronic
928964958 2:36966759-36966781 CCGCCCCGGCTCGCCGCGTAGGG + Intergenic
934566852 2:95346236-95346258 CCGCGCGGGCCAGCGGCGCGGGG + Intronic
942965784 2:181891677-181891699 CCGCGCGGCCCCGGCCGGAAGGG + Intergenic
944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG + Intronic
1172118769 20:32585635-32585657 CCCCGCGGGACCGCCGCGTCCGG - Intronic
1174607062 20:51768538-51768560 CCGCGCGGGCGCTCCGCGCGTGG - Exonic
1176546690 21:8205401-8205423 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1176554585 21:8249591-8249613 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1176565641 21:8388448-8388470 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1176573506 21:8432616-8432638 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1182222973 22:28773093-28773115 CTGCCCGCGCCCGCCGCGAGGGG - Intronic
1183483010 22:38075189-38075211 CGGGGCGGGGCCGCCGCGCAAGG + Exonic
1183665140 22:39242556-39242578 CCGCGGGGGGCGGCCGCGGAAGG + Intronic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
1184759407 22:46536474-46536496 CCGGGCGGGGCCGGCGCGACGGG - Exonic
1185345078 22:50307456-50307478 CCGCCCGGGCCTGCCGCGCTGGG - Intronic
1203251555 22_KI270733v1_random:121667-121689 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1203259605 22_KI270733v1_random:166749-166771 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
950710628 3:14810753-14810775 CCCCGCGGGGCGGCCGCGGAGGG + Intergenic
954176198 3:48847668-48847690 CCTCGCGGGCGCGGAGCGAAAGG - Exonic
955997055 3:64688167-64688189 CCGCACGGGCCGGCCGAGGAGGG - Intergenic
961665126 3:128489635-128489657 CCGCGGAGGCCCGGCGCCAAGGG - Intronic
962498388 3:135965639-135965661 CCGGGCGGGCCGGCCGCCGAGGG + Intergenic
967859741 3:194141715-194141737 CCGCGCGGCCCCGCCGGGCCTGG + Intergenic
968835798 4:2963618-2963640 CCGGGCGGGCTCGGCGCTAACGG - Intronic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
981069998 4:140524421-140524443 CCTCGCGCGCCGCCCGCGAATGG - Intronic
991298177 5:65103059-65103081 CCGCTCGGGCCCGGGGCGACCGG - Intergenic
992105893 5:73448599-73448621 CCGCCCGGGCCGGGCGCGAGCGG - Intergenic
996785060 5:127229349-127229371 CCGCCCGGGCCCGCCGCAGCCGG + Intergenic
1002046323 5:176543455-176543477 CCGCCCCGGCCCCGCGCGAATGG + Intronic
1011112435 6:83853482-83853504 CCGCGCCCGCGCGCCGCGTAGGG - Exonic
1015933796 6:138388317-138388339 GCGCGGGGGCCCTCCGTGAATGG - Intergenic
1017834972 6:158168543-158168565 CCGTGCGGCCCCGCCAGGAAGGG - Intronic
1021451138 7:20784856-20784878 CCGCGCCGGCCAGCGGCGACGGG + Exonic
1033253200 7:139777832-139777854 CCGCCCGGGCCCGGCGCGGGGGG + Intronic
1041109396 8:54470485-54470507 CCGCGCGCGCCGCCCGCCAAGGG - Intergenic
1045488652 8:102654272-102654294 CCCCGCGGGCCCGGCGCGCACGG - Intronic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1060087280 9:120714212-120714234 CCCCGCGGCCCCGCCGCCACCGG + Exonic
1060087476 9:120714935-120714957 CCGCGCGGGAACCCCGCGATGGG + Intergenic
1060811206 9:126612506-126612528 CCGCGGGGCCCCGCGGCGCAGGG + Intergenic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1203467957 Un_GL000220v1:104818-104840 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1203475778 Un_GL000220v1:148790-148812 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1189821326 X:44872779-44872801 CCGCTCGCGCCCGCCGCGGGCGG + Intergenic
1190554389 X:51618666-51618688 CCTCCCGGGCCCGCCGCCACCGG + Intergenic
1196443984 X:115735922-115735944 CCGCGCCGGCCCGCCCCGGCCGG + Intergenic
1200218436 X:154379026-154379048 CCGCGCGGGCGCGGAGCAAAAGG - Intergenic