ID: 944119537

View in Genome Browser
Species Human (GRCh38)
Location 2:196226138-196226160
Sequence GAGGCTGATCCCTTATGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 2, 1: 0, 2: 27, 3: 162, 4: 533}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944119525_944119537 22 Left 944119525 2:196226093-196226115 CCCCATTGCTGGGGGTGGGGCCT No data
Right 944119537 2:196226138-196226160 GAGGCTGATCCCTTATGGCTTGG 0: 2
1: 0
2: 27
3: 162
4: 533
944119533_944119537 2 Left 944119533 2:196226113-196226135 CCTGGTGGGAGGTGTTTGGATCA 0: 254
1: 2827
2: 5664
3: 8089
4: 10208
Right 944119537 2:196226138-196226160 GAGGCTGATCCCTTATGGCTTGG 0: 2
1: 0
2: 27
3: 162
4: 533
944119527_944119537 20 Left 944119527 2:196226095-196226117 CCATTGCTGGGGGTGGGGCCTGG No data
Right 944119537 2:196226138-196226160 GAGGCTGATCCCTTATGGCTTGG 0: 2
1: 0
2: 27
3: 162
4: 533
944119526_944119537 21 Left 944119526 2:196226094-196226116 CCCATTGCTGGGGGTGGGGCCTG No data
Right 944119537 2:196226138-196226160 GAGGCTGATCCCTTATGGCTTGG 0: 2
1: 0
2: 27
3: 162
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944119537 Original CRISPR GAGGCTGATCCCTTATGGCT TGG Intronic
900654178 1:3747007-3747029 GGGGCGGATCCCTTAGGGCTGGG + Intergenic
902964990 1:19994693-19994715 GAGGCTGATGACTTCTGGATGGG + Intergenic
903223246 1:21880626-21880648 GCGCCTGAGCCCTTAGGGCTGGG - Intronic
904259865 1:29282339-29282361 CAGGCTGGGGCCTTATGGCTTGG + Intronic
904856702 1:33503306-33503328 GAGGGAGATGCCTCATGGCTGGG + Intergenic
906335604 1:44927453-44927475 GGTGCGGATCCCTCATGGCTTGG - Intronic
906847811 1:49213410-49213432 GCGGCAGATCCCTCATGGCTTGG + Intronic
906873666 1:49512459-49512481 GGGGCAGATCCTTCATGGCTTGG + Intronic
907023258 1:51089275-51089297 GGGGCAGATCGCTTATGGCTTGG - Intergenic
907559120 1:55372229-55372251 GGGGTGGATCCCTTGTGGCTTGG + Intergenic
908206779 1:61858629-61858651 GGGGTGGATCCCTCATGGCTTGG - Intronic
908785553 1:67731437-67731459 GAGAGTGATTCCTTTTGGCTGGG + Intronic
908831163 1:68179946-68179968 TAGTCTGATCAGTTATGGCTTGG + Intronic
909060290 1:70871335-70871357 CAGGCAGATCCATCATGGCTTGG - Intronic
909116251 1:71541015-71541037 GGGGTGGATCCCTCATGGCTTGG - Intronic
909167554 1:72248081-72248103 CAGGCGGATCCCTCATGGCTTGG - Intronic
909573112 1:77140141-77140163 AGGGCAGATCCCTCATGGCTTGG + Intronic
909756272 1:79230024-79230046 GGGGCAGATCCTTCATGGCTTGG - Intergenic
911126815 1:94348137-94348159 GGGGCAGGTCCCTCATGGCTTGG + Intergenic
911138151 1:94465174-94465196 GAGGCAGATCCCTCATGGCATGG - Intronic
911468248 1:98282243-98282265 ACAGCTGATCCCTTATGGATTGG + Intergenic
911630201 1:100174912-100174934 GAGGAGGATCCCTCATGGCGTGG + Intronic
911698808 1:100926499-100926521 GGGACAGATCCCTCATGGCTTGG - Intronic
911761779 1:101625557-101625579 GGCGCAGATCCCTCATGGCTTGG + Intergenic
911819785 1:102403085-102403107 GGGGTGGATCCCTCATGGCTTGG - Intergenic
913032415 1:114922576-114922598 GGGGAGGATCCCTCATGGCTTGG - Intronic
913302666 1:117388635-117388657 GAGATGGATCCCTCATGGCTTGG - Intronic
913348295 1:117829740-117829762 GGGGCAGATCCCTCATGCCTTGG + Intergenic
916834113 1:168524627-168524649 TGGGCAGATCCCTCATGGCTTGG - Intergenic
917310717 1:173674918-173674940 TTGTCTGATCTCTTATGGCTAGG + Intergenic
917532533 1:175849814-175849836 GGGACAGATCCTTTATGGCTTGG - Intergenic
917572198 1:176279308-176279330 GGGGCAGATTCCTTATGGCATGG - Intergenic
917811149 1:178659554-178659576 TGGGCAGATCCCTTATGGATTGG - Intergenic
918294753 1:183145967-183145989 TGGGCTGATCCCTTAAGGTTAGG + Intergenic
918440182 1:184559183-184559205 GGGGAGGATCCCTCATGGCTTGG + Intronic
918692338 1:187497114-187497136 GGGGCGGATCCCTCATGGCTTGG - Intergenic
918726765 1:187936067-187936089 GAGGTGGATCCCTTATGGCTTGG + Intergenic
918963687 1:191312157-191312179 GGGGCGGATCCCTCATGGCTTGG + Intergenic
919074586 1:192797958-192797980 GGGGCAGATCTCTCATGGCTTGG + Intergenic
919577586 1:199331030-199331052 GGGGAGGATCCCTCATGGCTTGG - Intergenic
919965136 1:202515654-202515676 GAGGCTGATCACTTGAGCCTAGG - Intronic
920798541 1:209164081-209164103 GGGGTGGATTCCTTATGGCTTGG + Intergenic
921375806 1:214472211-214472233 GGGGTGGATCCCTTCTGGCTTGG + Intronic
921443946 1:215222118-215222140 GGGGTGGATCCCTCATGGCTTGG - Intronic
921572032 1:216791200-216791222 GGGGCAGATACCTCATGGCTTGG + Intronic
921618935 1:217305301-217305323 GGGGAGGATCCCTCATGGCTTGG + Intergenic
922335186 1:224613604-224613626 GGGGTGGATCCCTCATGGCTTGG + Intronic
923097280 1:230785457-230785479 GGGGCGGATCTCTCATGGCTTGG + Intronic
923999749 1:239537460-239537482 GGGGCGGATCCCTCATGGCTTGG - Intronic
924324771 1:242884694-242884716 GTGGTGGATCCCTTATGGCTTGG + Intergenic
1062972315 10:1658619-1658641 GAGGCTTGTCCTGTATGGCTGGG - Intronic
1063696593 10:8341517-8341539 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1063764415 10:9121572-9121594 GGGGCAGATCCCTCATGGCTAGG + Intergenic
1064125374 10:12655309-12655331 GGGGTGGATCCCTCATGGCTTGG - Intronic
1064421545 10:15195113-15195135 GGGACAGATCCCTTGTGGCTTGG - Intergenic
1065120508 10:22525700-22525722 GAGGCTGATCACCTTTGGATGGG + Intergenic
1065626588 10:27635503-27635525 AGGGCGGATCCCTCATGGCTTGG + Intergenic
1065688541 10:28309742-28309764 GGGGCGGATCCCTCGTGGCTTGG + Intronic
1066149848 10:32605037-32605059 GGGGCAGATCCCTCATGGCTTGG + Intronic
1066950103 10:42109184-42109206 GGGGCTGAGCCCTTATGAATGGG + Intergenic
1067798053 10:49335015-49335037 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1067798581 10:49339868-49339890 GGGGCGGATCCCTCATGGCTTGG + Intergenic
1068212039 10:53932877-53932899 GAGACAGATCCCTCATGGCTTGG + Intronic
1068264652 10:54631112-54631134 GAGGCTGATTCCTCATGGCTTGG + Intronic
1068507992 10:57927439-57927461 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1069946340 10:71988417-71988439 GGGGTGGATCCCTCATGGCTTGG + Intronic
1070092453 10:73301284-73301306 GAGGTGGATGCCTCATGGCTTGG + Intronic
1070581478 10:77723548-77723570 GAGGCAGCTCCCTCGTGGCTTGG + Intergenic
1070583149 10:77739302-77739324 GAGGTGGATCCCTCATAGCTTGG + Intergenic
1070841809 10:79492608-79492630 GAGGCTGCTTGCTTATGGTTTGG + Intergenic
1070937634 10:80313783-80313805 GGGGCAGAACCCTCATGGCTTGG - Intergenic
1070977127 10:80614409-80614431 GGGGCAGATTCCTCATGGCTTGG - Intronic
1071121790 10:82287184-82287206 GGGGCAGGTCCCTCATGGCTTGG + Intronic
1071242798 10:83727075-83727097 GAGGCAGATCTCTTAGGGCTTGG + Intergenic
1072505527 10:96062638-96062660 GGGGCGGATCCCTCATGGCTTGG - Intergenic
1073554596 10:104436633-104436655 GTGGTGGATCCCTCATGGCTTGG - Intronic
1074376035 10:112941441-112941463 GGGGCTGATCCCTCATGGCTTGG - Intergenic
1074473700 10:113750474-113750496 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1074702755 10:116106828-116106850 GGGACAGATCCCTCATGGCTTGG + Intronic
1074710848 10:116176408-116176430 GGGACAGATCCCTGATGGCTCGG + Intronic
1074900894 10:117815703-117815725 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1075915528 10:126162926-126162948 GGGGCGGATCCTTGATGGCTTGG + Intronic
1075966638 10:126617471-126617493 TAGGTTGAGCCATTATGGCTTGG + Intronic
1076028254 10:127134986-127135008 GCGGCTGATCCCTTGAGGCTGGG + Intronic
1076473845 10:130738757-130738779 GGGGAGGATCCCTTGTGGCTTGG + Intergenic
1077400038 11:2350570-2350592 GGGGCAGATCCCACATGGCTTGG + Intergenic
1077744884 11:4891421-4891443 GGGACAGATCCCTCATGGCTTGG - Intronic
1078994641 11:16685041-16685063 GGGGCAGATCCCTCATGGCTTGG - Intronic
1079147772 11:17869014-17869036 CAGGCTGATCACTTAAGGCCAGG - Intronic
1079299823 11:19268045-19268067 GGGGCGGATCCCTTATGGCTTGG - Intergenic
1079958687 11:26895511-26895533 GAGGCAGATTCCTTATGGCTTGG + Intergenic
1080165640 11:29232939-29232961 GGGACGGATCCCTTATGGCTTGG + Intergenic
1080480744 11:32647372-32647394 GGGGCAGATTCCTTATGGCTTGG - Intronic
1080572823 11:33571682-33571704 GAGGCAGCTCCCTCATGGCTTGG - Intronic
1080858954 11:36136449-36136471 GGGGCGGATCCTTCATGGCTTGG + Intronic
1081034716 11:38128674-38128696 GGGGCAGATCACTCATGGCTTGG - Intergenic
1081166161 11:39810941-39810963 GAGGCTGATGACTTTTGGATGGG - Intergenic
1081265284 11:41013962-41013984 GGGGTGGATCCCTCATGGCTTGG - Intronic
1082036871 11:47652074-47652096 GGGGCGGATCCCTCATGGCTTGG + Intergenic
1082128004 11:48455173-48455195 GAGGTGGATCCCTCATGACTTGG - Intergenic
1082998030 11:59268225-59268247 GGGGCTGATTCCTTAGGTCTTGG + Intergenic
1083785001 11:64939537-64939559 GAGGCTTCTCACTTATGTCTAGG - Intronic
1084180358 11:67442968-67442990 GAGGCTGCTCCCGACTGGCTGGG - Intronic
1084498843 11:69522662-69522684 GAGGCAGATCCCTCATGGCTTGG - Intergenic
1084962163 11:72722586-72722608 GAGGCTGATCACTTGTTGCCAGG - Intronic
1086418918 11:86618654-86618676 GGGGCAGATCCCTCATGGTTTGG + Intronic
1086774421 11:90812446-90812468 GGGGCAAATCCCTCATGGCTTGG - Intergenic
1087095659 11:94314977-94314999 GAGGCAGATCCCTCATGACTTGG + Intergenic
1087192347 11:95268177-95268199 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1087302839 11:96455952-96455974 GAGGTGGATTCCTCATGGCTTGG + Intronic
1087412498 11:97809221-97809243 GGGGCAGATCACTCATGGCTTGG + Intergenic
1087709582 11:101533454-101533476 GTGGCAGATCCCTCATGGCTTGG - Intronic
1087870970 11:103292629-103292651 GGGGCAGATCCCTTGTGGCTTGG + Intronic
1087993853 11:104779578-104779600 GGGGCAGATCCCTTATGGCTTGG + Intergenic
1088073755 11:105821617-105821639 GGGGTGGATCCCTCATGGCTGGG - Intronic
1088109768 11:106247720-106247742 GGGGCAGATCCCTCATTGCTTGG + Intergenic
1088351966 11:108899745-108899767 GGGGCAGATTCCTCATGGCTTGG + Intronic
1088566938 11:111182581-111182603 GGGGATGATCCCTCATAGCTTGG + Intergenic
1088767131 11:112993385-112993407 GGAGCAGATCCCTCATGGCTTGG - Intronic
1089664082 11:120006373-120006395 GGGGCAGATCTCTCATGGCTTGG - Intergenic
1090321280 11:125845470-125845492 GAGGCTGCTGACTTTTGGCTGGG - Intergenic
1090678780 11:129030836-129030858 GGGGCAGATCCCTCATGGCTTGG + Intronic
1091713195 12:2756981-2757003 GGGGCGGTTCCCTTGTGGCTTGG - Intergenic
1092082378 12:5727161-5727183 GGGGTGGATCCCTCATGGCTTGG + Intronic
1092468521 12:8756917-8756939 GAGGCTGATCACTTGAGGCCAGG - Intronic
1093061990 12:14616993-14617015 GGGGTGGATCCCTCATGGCTTGG + Intronic
1093100131 12:15018000-15018022 GGGGCGGATTCCCTATGGCTTGG + Intergenic
1093295940 12:17391687-17391709 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1093440843 12:19193998-19194020 GCGGTGGATCCCTCATGGCTTGG - Intronic
1094452545 12:30597882-30597904 GGGGCAGATGCCTCATGGCTTGG - Intergenic
1095743907 12:45636067-45636089 GGGGCAGATCCTTTCTGGCTTGG + Intergenic
1095811602 12:46377764-46377786 GAGGCAGAGCCCTCATGACTTGG - Intergenic
1095968122 12:47883037-47883059 GAGGCTGTTTCCTTCTGCCTGGG - Intronic
1096757267 12:53810341-53810363 AAGGCTGGTTCCTTGTGGCTTGG - Intergenic
1097510319 12:60530419-60530441 GAGGCAGATCCCTCATGACTTGG + Intergenic
1098055644 12:66502561-66502583 GGGGCAGATTCCTCATGGCTTGG + Intronic
1098094999 12:66945641-66945663 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1098547550 12:71728271-71728293 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1098768785 12:74525183-74525205 GAGGAGGATCCCTCATGGCTTGG - Intergenic
1099095107 12:78365623-78365645 GGGGCGGATCCTTCATGGCTTGG + Intergenic
1099475480 12:83103566-83103588 GGGGTGGATCCCTCATGGCTTGG - Intronic
1100208419 12:92376233-92376255 AAGGCAGATCCCTCATGGCTTGG + Intergenic
1100383400 12:94083342-94083364 GGGGCACATCCCTCATGGCTTGG + Intergenic
1100465038 12:94836935-94836957 GGGGCAGATCCCTCATGTCTTGG - Intergenic
1100971711 12:100078151-100078173 GGGGCAGATACCTCATGGCTTGG + Intronic
1101034574 12:100692662-100692684 GAGGCAGATTCCTCATGGCTTGG + Intergenic
1103496580 12:121367417-121367439 GAGGCTGTTCCCTTCAGCCTAGG - Intronic
1103645605 12:122389903-122389925 GGGGCGGATCCCTCATGGCTAGG + Intronic
1103915743 12:124374767-124374789 GAGGCTGATGACTTAGGGCAAGG - Intronic
1104331971 12:127855532-127855554 GGGGCGGATCCTTCATGGCTTGG - Intergenic
1105046621 12:133009039-133009061 GGGGCAGATCCCTCATGGCTTGG - Intronic
1105238207 13:18582232-18582254 GAGGCAGATCTCTCATGACTTGG - Intergenic
1108031291 13:46232169-46232191 GGGGCAGATCTCCTATGGCTTGG - Intronic
1108421360 13:50253090-50253112 GGGGCTCATCCCACATGGCTGGG - Intronic
1109251994 13:60031299-60031321 GGGTCAGATCCCTCATGGCTTGG - Intronic
1109584849 13:64386427-64386449 AGGGCAGATCCCTCATGGCTTGG - Intergenic
1109903225 13:68802166-68802188 GGGGCAGATCCTTCATGGCTTGG + Intergenic
1110550702 13:76808170-76808192 GGGGCAAATCCCTCATGGCTTGG + Intergenic
1110643286 13:77851823-77851845 GAGGCAGATTCCTCATGGCTTGG + Intergenic
1111556690 13:89890036-89890058 GAGGCGGGTCTCTCATGGCTTGG + Intergenic
1111631010 13:90846225-90846247 GAGGCGGATCCCTCATGGCTTGG + Intergenic
1111817272 13:93169439-93169461 GGGGCGGATCCCTCATGGCTTGG + Intergenic
1111894728 13:94127307-94127329 GGGACAGATCCCTCATGGCTTGG + Intronic
1112080846 13:95968496-95968518 GGGGCAGATCCCTCATGTCTTGG + Intronic
1112223961 13:97519160-97519182 GAGGCAGATCCCTCATGGCTTGG - Intergenic
1112718425 13:102213799-102213821 GAGGCTGGTAACTGATGGCTGGG - Intronic
1112909333 13:104462572-104462594 GGGGCAGATCCCTCATGGCTCGG - Intergenic
1113499414 13:110761319-110761341 GAGGTGGATCCCTCATGGCTTGG + Intergenic
1115140948 14:30170216-30170238 GGGGCAGATCCCTCATGGTTTGG - Intronic
1115146804 14:30236201-30236223 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1115196556 14:30806783-30806805 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1116061102 14:39925193-39925215 GGGGCAGATCCCGCATGGCTTGG - Intergenic
1116690143 14:48095483-48095505 GGGGCAGATCACTCATGGCTTGG - Intergenic
1117456794 14:55905903-55905925 CGGGCAGATCCCTCATGGCTTGG - Intergenic
1117477517 14:56111512-56111534 GGGGCAGAGCCCTCATGGCTTGG + Intergenic
1117757394 14:58989955-58989977 AAGGCAGATCCCTTATGAATGGG - Intergenic
1117800092 14:59434286-59434308 GGGGCAGATTCCTTATGGTTTGG - Intronic
1118268397 14:64317556-64317578 GGGGCAGATCCCTCATGGCTTGG - Intronic
1118814284 14:69298877-69298899 GAGGCAGCTCCCTCTTGGCTGGG - Intronic
1119147000 14:72326438-72326460 GGGGCAGACCCCTTATGTCTTGG + Intronic
1119656037 14:76417824-76417846 GTGGCTCCTCCCTTATGGCCAGG - Intronic
1119862125 14:77943883-77943905 GAGGCGGGTCCTTCATGGCTTGG - Intergenic
1120040784 14:79750624-79750646 GAGGCTGTTTCCTAATGGGTAGG - Intronic
1120106953 14:80506941-80506963 GAGGTGGATCCCTCATGGCTTGG + Intronic
1121481237 14:94276630-94276652 GGGGCTGATCCCTCACGGCTTGG - Intronic
1121577707 14:95001818-95001840 AGGGCAGATCCCTTATGGATGGG - Intergenic
1124223479 15:27869833-27869855 CAGGCTGATGCCTTCTGGCAGGG - Intronic
1126052780 15:44701971-44701993 GGGGCAGATCCCTCATGGCTTGG - Intronic
1126654716 15:50964863-50964885 AAGGCAGATACCTCATGGCTTGG + Intronic
1126718122 15:51544229-51544251 GAGGCGGATCCCGCATGGCTTGG + Intronic
1126815187 15:52447199-52447221 GGGGCGGCTCCCTCATGGCTTGG + Intronic
1127263002 15:57339340-57339362 GGAGCCGATCCCTCATGGCTTGG + Intergenic
1127406627 15:58655487-58655509 GGGGCAGATCCCCCATGGCTTGG - Intronic
1128277261 15:66364014-66364036 GGGGTGGATCCCTCATGGCTTGG - Intronic
1128336982 15:66793158-66793180 GCGGCGGATCCCTCATGGCTTGG + Intergenic
1128534025 15:68476763-68476785 GGGGCAGATCCTTCATGGCTTGG + Intergenic
1128643365 15:69356962-69356984 GGGGCAGATCCCTCGTGGCTTGG + Intronic
1129093772 15:73181692-73181714 GGGGAAGATCCCTCATGGCTTGG - Intronic
1129173658 15:73823673-73823695 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1129614622 15:77088588-77088610 GGGGCAGATCCCCCATGGCTTGG + Intergenic
1129970982 15:79777723-79777745 GAGGCAGATCCCTCATGGCTAGG - Intergenic
1130075660 15:80687248-80687270 GGGGCGGATCCCTCATGGCTTGG + Intronic
1130273803 15:82466091-82466113 GAGGCTGAGCCCTTGAGCCTAGG + Intergenic
1130466151 15:84193463-84193485 GAGGCTGAGCCCTTGAGCCTAGG + Intergenic
1130498112 15:84480073-84480095 GAGGCTGAGCCCTTGAGCCTAGG - Intergenic
1130588443 15:85198058-85198080 GAGGCTGAGCCCTTGAGCCTAGG + Intergenic
1131606779 15:93913386-93913408 GGGGCAGATTCCTCATGGCTTGG + Intergenic
1131939730 15:97547678-97547700 TAGGCAGATCCCTCATGTCTTGG - Intergenic
1133474188 16:6103946-6103968 GAGGCTGAGCCCCAATGGCTAGG - Intronic
1133863979 16:9624474-9624496 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1135602496 16:23795392-23795414 CAGGCTGATCACTTGAGGCTGGG - Intergenic
1135981067 16:27147706-27147728 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1136023304 16:27453878-27453900 CAGGCGGATCCCTTGAGGCTAGG + Intergenic
1137283033 16:46994064-46994086 GAAGTTGATATCTTATGGCTGGG + Intergenic
1138246025 16:55467861-55467883 GAGGCTGGTCCCTTCTGCCAGGG + Intronic
1138277099 16:55743040-55743062 AAGGCTGATTCCATATGGCATGG + Intergenic
1138285945 16:55810384-55810406 AAGGCTGATTCCATATGGCATGG - Intronic
1138711169 16:58971890-58971912 GGAGCTGATCCCTTATGGCTTGG - Intergenic
1139183297 16:64771899-64771921 GAGGTGGATCCCTCATGGTTTGG - Intergenic
1139540773 16:67614399-67614421 GAGGATGAGCCTTGATGGCTGGG + Intronic
1140779421 16:78281242-78281264 GGGGCGGAGCCCTCATGGCTTGG - Intronic
1141069671 16:80942270-80942292 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1143991302 17:10964702-10964724 GGGGTGGATCCCTAATGGCTTGG + Intergenic
1144703129 17:17351437-17351459 GTGGCAGAGCCCTTCTGGCTGGG + Intergenic
1146538809 17:33676884-33676906 GAGGTGGATCCCTTATGGTTTGG + Intronic
1150042480 17:61878835-61878857 GAGGAAGATCCCTTATGCCCAGG + Intronic
1150199107 17:63335031-63335053 GGGGCAGATCCCTCAAGGCTTGG - Intronic
1150329620 17:64284443-64284465 GGAGCGGATCCCTCATGGCTTGG - Intergenic
1151122323 17:71807227-71807249 GCTGCGGATCCCTCATGGCTTGG - Intergenic
1151136162 17:71947382-71947404 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1153110294 18:1578578-1578600 GGGGCAGATCTCTCATGGCTTGG + Intergenic
1153562892 18:6389112-6389134 GACCCCAATCCCTTATGGCTTGG - Intronic
1153771743 18:8422241-8422263 GGGACAGATCCCTCATGGCTTGG + Intergenic
1153954008 18:10080751-10080773 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1154083461 18:11280122-11280144 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1154511598 18:15110072-15110094 GAGGCAGATCTCTCATGACTTGG - Intergenic
1154515734 18:15163255-15163277 GGGGCTGAGCCCTTATGAATGGG + Intergenic
1155125433 18:22870635-22870657 GAGTCAGAACCTTTATGGCTTGG + Intronic
1155816993 18:30324517-30324539 CAGGCTGATCCCTCATGAATAGG - Intergenic
1155861119 18:30901124-30901146 GAAGAGGATCCCTCATGGCTTGG - Intergenic
1156154841 18:34289109-34289131 GAGGCAGATCCCTCATGGCTTGG - Intergenic
1156694242 18:39747749-39747771 GAAGCTGATCCCTCATGAATAGG + Intergenic
1156866200 18:41891415-41891437 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1156889321 18:42171705-42171727 TAGGCAGATCACTTATGGCCAGG - Intergenic
1157034446 18:43954003-43954025 GAGGCGGATTCCTCATGGCTCGG + Intergenic
1157524887 18:48373201-48373223 GGGGCGGATCCCTCACGGCTTGG + Intronic
1157999051 18:52594835-52594857 GGGGCAGATCTCTCATGGCTTGG - Intronic
1158517678 18:58144426-58144448 GGGGTGGATCCCTCATGGCTTGG - Intronic
1158815171 18:61086730-61086752 GGGGCAGATTCCTCATGGCTTGG + Intergenic
1159096294 18:63906191-63906213 GAGGCTGATCCCTTATGGCTTGG + Intronic
1159563925 18:70026353-70026375 GGGGCGGATTCCTCATGGCTTGG + Intronic
1160255776 18:77247586-77247608 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1160291948 18:77603053-77603075 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1161127883 19:2570052-2570074 GAGGGGGGTCCCTCATGGCTTGG + Intronic
1161511396 19:4674200-4674222 GAGGCTGATCTCAAATGCCTGGG + Intergenic
1161763709 19:6194045-6194067 GGGGCGGATCCCTCATGGCTTGG - Intronic
1162604918 19:11699211-11699233 GAGGCAGATCACTTGAGGCTAGG + Intergenic
1162779183 19:12997716-12997738 GAGCCTGCTCCCCCATGGCTTGG + Intronic
1162807243 19:13144371-13144393 CAGGCTGGTCCCTTAAGCCTGGG - Exonic
1162980205 19:14234130-14234152 GAGGCGGATCACTTGTGGCCAGG + Intergenic
1163108756 19:15143994-15144016 GAGGCAGATTCCTCATGGCTTGG + Intergenic
1163195255 19:15714941-15714963 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1164448680 19:28339763-28339785 GGGGCAGATCTCTCATGGCTTGG + Intergenic
1164913421 19:32030253-32030275 GAGCCTCATCCCTGATGGGTGGG + Intergenic
1166866052 19:45838084-45838106 GGGGCAGATCCCTCATGGCTTGG + Intronic
1167520784 19:49953326-49953348 GAGGCTGATCACTTCTTGCGGGG + Intronic
1168010786 19:53530231-53530253 GAGGCAGATCCCTCATGTCTTGG - Intronic
1168569152 19:57450485-57450507 GAGTCTGATCCCTTCGGGCGAGG + Intronic
925763805 2:7211676-7211698 GGGACAGATCCCTCATGGCTTGG + Intergenic
926990449 2:18674611-18674633 GATCCAAATCCCTTATGGCTTGG + Intergenic
927154631 2:20214386-20214408 GGGGCTGGTCCCTTCTGGTTTGG + Intronic
927838906 2:26424477-26424499 CAGGCAGATCCCCTGTGGCTGGG - Intronic
928318845 2:30267307-30267329 GGGGCGGATCCCTAATGGCTTGG - Intronic
928335697 2:30396216-30396238 GAGGCTGATCACCTAAGTCTGGG - Intergenic
928964894 2:36966565-36966587 GAGGCTGCTCCCTGCTGACTGGG - Intergenic
929255140 2:39802453-39802475 GGGGTGGATCCCTAATGGCTTGG - Intergenic
930118457 2:47740168-47740190 GGGGTGGATCCCTCATGGCTTGG - Intronic
930705437 2:54500763-54500785 CAGGCAGATCCCTTGAGGCTAGG - Intronic
931410606 2:62026450-62026472 GGGGCAGATCCTTTATGGCTTGG - Intronic
931552400 2:63461272-63461294 GAGGCAGATTCCTCATGGTTTGG + Intronic
932461002 2:71881967-71881989 GAACCTGAGCCCTGATGGCTGGG + Intergenic
933850783 2:86364940-86364962 AGGGCAGATCCCTCATGGCTTGG - Intergenic
934015959 2:87882066-87882088 GAGATAGATCCCTCATGGCTTGG - Intergenic
934539632 2:95163122-95163144 GGGGCAGATCCCTCATGGCTTGG - Intronic
934611398 2:95739569-95739591 GGGGTGGATCCCTCATGGCTTGG + Intergenic
934891503 2:98074458-98074480 GGGGCAGATTCCTCATGGCTTGG - Intergenic
935299842 2:101684697-101684719 GGGGCAGATTCCTCATGGCTTGG - Intergenic
935300360 2:101688430-101688452 GGGGTGGATCCCTCATGGCTTGG + Intergenic
935715828 2:105938107-105938129 GGGGTGGATCCCTCATGGCTTGG + Intergenic
936544726 2:113381135-113381157 GAGGTGGATCCCTCATGGCTTGG + Intergenic
936684188 2:114808675-114808697 GAGGCTGCAGCCTTATGGCAAGG - Intronic
936777911 2:115995946-115995968 GAGGCACATACCTCATGGCTTGG + Intergenic
936890000 2:117358379-117358401 GGGGCAGATCCCTCATGGCTTGG + Intergenic
938227522 2:129628527-129628549 GAGGCGGTACCCTCATGGCTTGG + Intergenic
938511169 2:131946790-131946812 GAGGCAGATCTCTCATGACTTGG - Intergenic
938515995 2:132008031-132008053 GGGGCTGAGCCCTTATGAATGGG + Intergenic
938844439 2:135194441-135194463 GGGGCGGATCCCTCATCGCTTGG - Intronic
938941663 2:136175127-136175149 GAGTCTGATGCCTGATTGCTTGG + Intergenic
939111779 2:138017237-138017259 GAGGCAGATCCCTTAAGGTGGGG - Intergenic
939167360 2:138654011-138654033 GGGGCGGATTCCTCATGGCTTGG - Intergenic
939364521 2:141215087-141215109 GGGGTAGATCCCTTATGGCTTGG + Intronic
939834490 2:147112016-147112038 GGGGTGGATCCCTCATGGCTTGG + Intergenic
940507185 2:154570667-154570689 TGGGCGGATCCCTCATGGCTTGG + Intergenic
942519272 2:176786103-176786125 GAAGCGGATCCCTCATGGCTTGG + Intergenic
943348534 2:186770272-186770294 GAGGTGAATCCCTTGTGGCTTGG - Intergenic
943602869 2:189942181-189942203 GGTGCAGATCCCTCATGGCTTGG + Intronic
944119537 2:196226138-196226160 GAGGCTGATCCCTTATGGCTTGG + Intronic
944187722 2:196967888-196967910 GGGGTGGATCCCTCATGGCTTGG + Intronic
945323561 2:208456009-208456031 CAGGCTGATCCCTTGAGGCCAGG + Intronic
945410117 2:209497798-209497820 GGAGGTGATCCCTTATGGCTTGG - Intronic
945886087 2:215377381-215377403 GGGGCAGATCCCTTGTGGCTTGG + Intronic
946649874 2:221880701-221880723 GCAGCAGATTCCTTATGGCTTGG - Intergenic
947004299 2:225492823-225492845 GAGGCAGATCCCTCATGGCCTGG - Intronic
947050322 2:226035353-226035375 GAGGCAGATCTCTCATGGCTTGG - Intergenic
947107879 2:226686423-226686445 GGGGCAGATCCCTTGTGGTTGGG + Intergenic
947561830 2:231161117-231161139 GAGGAGGATCCCTTAAGGCCAGG + Intronic
948106993 2:235422134-235422156 GAGGCAGATCCCTTAAGCCCAGG + Intergenic
1169313585 20:4569329-4569351 GAAGCAGATCCCTTATGGCTTGG - Intergenic
1169680313 20:8204525-8204547 GGGGCAGATCCCTCATGGCTTGG + Intronic
1169841674 20:9944620-9944642 GGGGCAGATCTCTCATGGCTTGG - Intergenic
1169955710 20:11100537-11100559 CAGGCAGATCACTTATGGCCAGG - Intergenic
1170439053 20:16359255-16359277 CGGGTGGATCCCTTATGGCTTGG + Intronic
1170970999 20:21116505-21116527 GGGGCAGATCCCTTATGGCTTGG - Intergenic
1171285005 20:23929785-23929807 GTTTCTGATCCCTCATGGCTTGG + Intergenic
1171302449 20:24075592-24075614 GGGGCGGATCCCTCATGGCTTGG - Intergenic
1171725192 20:28611349-28611371 GAGGTGGATCCCTCATGACTTGG + Intergenic
1171752881 20:29071737-29071759 GAGGTGGATCCCTCATGGCTTGG - Intergenic
1171789383 20:29505829-29505851 GAGGTGGATCCCTCATGGCTTGG + Intergenic
1171858151 20:30368612-30368634 GAGGTGGATCCCTCATGGTTTGG - Intergenic
1171948853 20:31402991-31403013 GAGGATGATCACTTAAGGCCAGG + Intergenic
1173463030 20:43259241-43259263 GAGGTGGATCCCTCCTGGCTTGG + Intergenic
1173768846 20:45640285-45640307 GGGGCAGACCCCTCATGGCTTGG - Intergenic
1174211996 20:48887152-48887174 GAGGCTGATCAGTAATAGCTGGG - Intergenic
1174356490 20:50001692-50001714 CAGGAGGATCCCTTAAGGCTAGG + Intergenic
1174945756 20:54983585-54983607 GAGGCTACTCCCTTAGGGCATGG + Intergenic
1175178277 20:57126933-57126955 GAGGCAGATGCCTTCAGGCTGGG + Intergenic
1175343961 20:58256845-58256867 GGGGTGGATCCCTTATTGCTTGG + Intergenic
1175942611 20:62544877-62544899 GGGGTGGATCCCTCATGGCTGGG - Intergenic
1176727340 21:10449875-10449897 GGGGCAAATCCCTCATGGCTTGG - Intergenic
1176782193 21:13210509-13210531 GAGGCAGATCTCTCATGACTTGG - Intergenic
1177043297 21:16139579-16139601 GGGGCAGGTCCCTCATGGCTTGG - Intergenic
1177312983 21:19421296-19421318 GGGGCAGATCACTCATGGCTTGG + Intergenic
1177406223 21:20672184-20672206 GAAGCAGATCCCTCGTGGCTTGG + Intergenic
1177980299 21:27905135-27905157 GAGGCAGATCTCTCATGACTTGG + Intergenic
1178218130 21:30624626-30624648 GAGGCAGATTCCTTATGGCCTGG - Intergenic
1178310269 21:31524387-31524409 GGGGCGGATCCCTCTTGGCTTGG - Intronic
1178835669 21:36095473-36095495 CAGGCAGATCACTTATGGTTAGG + Intergenic
1179147195 21:38778499-38778521 GGGGCGGATCCTTCATGGCTTGG + Intergenic
1179407624 21:41138496-41138518 GAGACGGATCCCTCCTGGCTTGG + Intergenic
1180287059 22:10757150-10757172 GGGGCAAATCCCTCATGGCTTGG + Intergenic
1180409676 22:12593796-12593818 GAGGTGGATCCCTCATGGCTTGG - Intergenic
1181812556 22:25412850-25412872 GGGGCAGATCCCTCGTGGCTTGG - Intergenic
1182866611 22:33609775-33609797 GGGGCGGATCCCTCATGGCTTGG + Intronic
1182866896 22:33611829-33611851 GGGGTGGATCCCTAATGGCTTGG + Intronic
1182908290 22:33957542-33957564 GGGGCAGATCCCTCATAGCTTGG + Intergenic
1183774913 22:39957705-39957727 GAGGAGGATCACTTGTGGCTAGG + Intronic
1183847652 22:40555348-40555370 GGGGCAGATCCCTCATGGATTGG + Intronic
1184447651 22:44559645-44559667 GGGGTGGATCCCTTATGGCTTGG - Intergenic
949642553 3:6054531-6054553 GGGCCAGATCCCTTATGGCTTGG - Intergenic
949661532 3:6284297-6284319 GAGGGTGATCCCATAAGGCCTGG + Intergenic
949772825 3:7597304-7597326 GAGGCAGATCCCTCATGGCTTGG - Intronic
950476087 3:13215776-13215798 GTGGCTGATGCCATATAGCTGGG + Intergenic
950776217 3:15352585-15352607 GAGACAGATCCCTAATGGCTTGG + Intergenic
950917108 3:16657170-16657192 GGGGCAGATCCCTCGTGGCTTGG - Intronic
951238118 3:20258552-20258574 AAGGCAGATTCCTTAGGGCTAGG - Intergenic
952042033 3:29272402-29272424 AGGGCTGATCCCTCATGGCTTGG - Intergenic
952132652 3:30383368-30383390 GCAGCAGATCCCTCATGGCTTGG + Intergenic
952607868 3:35172098-35172120 GAGGCTGATGACCTTTGGCTGGG + Intergenic
952766745 3:36960937-36960959 AAGGCTAATCCCTCATGGATGGG - Intergenic
953237380 3:41118652-41118674 GGGGCGGATCTCTCATGGCTTGG - Intergenic
954460929 3:50626503-50626525 GAGGCTGAACCCTTAAGAATGGG - Intronic
955167393 3:56527772-56527794 GGAGCAGATCCCTTGTGGCTTGG + Intergenic
956052019 3:65258059-65258081 GGAGCAGATCCCTCATGGCTTGG - Intergenic
956238430 3:67102777-67102799 GGGGCATATCCCTCATGGCTTGG + Intergenic
956238683 3:67104733-67104755 AAGGTGGATTCCTTATGGCTTGG + Intergenic
956327746 3:68071890-68071912 GGGGCGGATCCCTCATGGCTTGG - Intronic
956607009 3:71083165-71083187 GGGGCAGATCCCTCATGTCTTGG + Intronic
957559159 3:81799556-81799578 GGGGCTGATTCATTATGGCCAGG - Intergenic
957599960 3:82321195-82321217 GAGGTGAATCCCTCATGGCTTGG - Intergenic
957715571 3:83926272-83926294 GGGGTGGATCCCTCATGGCTTGG + Intergenic
957772726 3:84715300-84715322 GTGGCAGATCCCTCATGACTTGG + Intergenic
958824199 3:99009941-99009963 GAGGCTGCTCCCTCATGGCCTGG - Intergenic
959050945 3:101524726-101524748 GGGGCAGATCCCTCATAGCTTGG + Intergenic
959051281 3:101527067-101527089 GGGGCAGATTCCTGATGGCTTGG + Intergenic
959135149 3:102409343-102409365 AGGGCAGATCCCTCATGGCTTGG + Intronic
959875802 3:111380539-111380561 GAGGCTGATGACCTATGGATGGG - Intronic
960345264 3:116522556-116522578 GGGGCAGATCCTTCATGGCTTGG + Intronic
961259107 3:125585361-125585383 CAGGCTGATCACTTGAGGCTAGG - Intronic
961416281 3:126760071-126760093 GGGGCAGATCCTTCATGGCTTGG - Intronic
961765000 3:129203136-129203158 GGGGCAGATCCCTCATGGCTTGG + Intergenic
962005466 3:131344848-131344870 GGAGCTGTTCCCTCATGGCTTGG - Intronic
962191160 3:133312451-133312473 GAGGCTGCTGCCTTGTGGCGGGG - Intronic
962316896 3:134364596-134364618 TAGGCTGGTCTCTTCTGGCTGGG - Intronic
962378238 3:134876331-134876353 GAGGCTGAGCCCTACAGGCTGGG - Intronic
962440725 3:135413543-135413565 GGGGCGGATCCCTCATAGCTTGG + Intergenic
963261470 3:143195816-143195838 GAGGCGGATCCCTCGTGGCTAGG + Intergenic
963334850 3:143963105-143963127 GGGGCAGATCCCTCATGGCTAGG - Intergenic
963413275 3:144960138-144960160 GAAGAGGATCCCTTGTGGCTTGG - Intergenic
963633823 3:147768122-147768144 GAGGTGGATACCTCATGGCTTGG + Intergenic
964061023 3:152522885-152522907 GGGGTGGATCCCTCATGGCTTGG - Intergenic
964092259 3:152891628-152891650 GGGGTGGATCCCTCATGGCTTGG - Intergenic
964284299 3:155100995-155101017 GGGGCAGATCCCTAATGACTTGG + Intronic
964480998 3:157138334-157138356 GGGGTGGATCCCTCATGGCTTGG - Intergenic
964920152 3:161886044-161886066 GAGGTGGATTCCTCATGGCTTGG + Intergenic
965030960 3:163367386-163367408 GAAGTGGATCCCTCATGGCTTGG + Intergenic
965083125 3:164061645-164061667 GAGGCAGATGCCTTATGGACCGG - Intergenic
965127781 3:164651466-164651488 GGGGCAGATTCCTCATGGCTTGG - Intergenic
966400050 3:179538648-179538670 ATGGCGGATCCCTCATGGCTTGG - Intergenic
967170111 3:186816565-186816587 GGGGCGGATTCCTCATGGCTTGG - Intergenic
967329519 3:188276570-188276592 GGGGCGGATCCCTCATGACTTGG + Intronic
967526775 3:190504150-190504172 GAGTCAGATCCCTCATAGCTTGG - Intergenic
967805818 3:193713720-193713742 GGGGCAGATCCCTCATGGTTTGG + Intergenic
967806103 3:193715786-193715808 GGGGCAGATCCCTCATGGCATGG + Intergenic
967906834 3:194508357-194508379 CAGGCTGATCACTTAAGGCCAGG - Intergenic
967931372 3:194692942-194692964 GAGGTGGATCCCTTATGAATAGG - Intergenic
968674223 4:1868975-1868997 CAGGAGGATCCCTTAAGGCTAGG - Intergenic
969184320 4:5464182-5464204 GGGACGGATCCCTCATGGCTAGG - Intronic
969374452 4:6754021-6754043 TAGGGTGATCCCTTCTGCCTGGG - Intergenic
969391057 4:6891614-6891636 GAGGTGGATCCCTCGTGGCTTGG - Intergenic
969552971 4:7884023-7884045 GGGGTGGATCCCTCATGGCTTGG + Intronic
969886375 4:10219052-10219074 GAGGCTCCTGCCTTAAGGCTTGG + Intergenic
969896910 4:10313824-10313846 GAAGTGGATCCCTCATGGCTTGG + Intergenic
969951685 4:10843485-10843507 GGGGCAGATCCCTCATGCCTTGG - Intergenic
970237860 4:13976788-13976810 GGGGCAGATCTCTCATGGCTTGG - Intergenic
970572721 4:17398617-17398639 GGGGCAGATCCTTTATGGATTGG - Intergenic
970715443 4:18916640-18916662 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
971494592 4:27250551-27250573 GGGGTGGATCCCTCATGGCTTGG - Intergenic
971566253 4:28145285-28145307 GCGGCAGATCCCTAATGGTTTGG - Intergenic
972196054 4:36655347-36655369 GAAGTGGATCCCTCATGGCTTGG - Intergenic
972372342 4:38437355-38437377 GAGGCTGATGACTTTTGGATGGG + Intergenic
972385462 4:38561484-38561506 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
972393107 4:38631808-38631830 CAGGCGGATCACTTAAGGCTAGG + Intergenic
973542127 4:51945263-51945285 GAGGCAGATCCCTCTTGGTTTGG + Intergenic
973582854 4:52361405-52361427 GGGCCAGATCCCTCATGGCTTGG + Intergenic
973626591 4:52778750-52778772 GGGGCAGATCCCTCATGGCTTGG - Intergenic
973976663 4:56269801-56269823 GGGGCGGATCCCTCATGGCCTGG - Intronic
974192123 4:58519027-58519049 GAGGGAGATCCCTCATAGCTTGG - Intergenic
974302173 4:60082271-60082293 GAGGCTGATAACTTTTGGATGGG - Intergenic
974349342 4:60724355-60724377 GGGGTGGATCCCTCATGGCTTGG + Intergenic
974457269 4:62144522-62144544 GGGGCAAATCCCTTATGTCTTGG + Intergenic
974457516 4:62146560-62146582 GGGGTTGATCCCTCATGTCTTGG + Intergenic
974510545 4:62834704-62834726 GGGGTGGATCCCTCATGGCTTGG + Intergenic
974661252 4:64892605-64892627 GAGTCTGATCCCTTTTGGGATGG + Intergenic
974787137 4:66633163-66633185 GGGGCAGATCCCTCATGGCTTGG - Intergenic
975435145 4:74343461-74343483 GGGGTGGATCCCTCATGGCTTGG - Intergenic
976453386 4:85218219-85218241 GAGCCGGATCCCTCATGGCTGGG + Intergenic
976533539 4:86184600-86184622 GAGATGGATCCCTTGTGGCTTGG + Intronic
977983216 4:103350457-103350479 GGGGCAGATCCCTTATGGCTTGG + Intergenic
978017070 4:103757662-103757684 GGGACAGATCCCTCATGGCTTGG - Intergenic
978133314 4:105226504-105226526 GGGGCAGATCCCTCATGGCATGG + Intronic
978178052 4:105758381-105758403 GGGGCAGATCCCTCATGTCTTGG + Intronic
978627979 4:110709191-110709213 GAGGAGGATCCCTCATGGCTTGG + Intergenic
978926053 4:114246179-114246201 GGGGCAGATCCCTTATGGCTTGG - Intergenic
979891046 4:126095661-126095683 GTGGCAGATCCCTCAGGGCTTGG - Intergenic
980705514 4:136488165-136488187 GAGGCGGATCCTTCATGGTTTGG - Intergenic
980798636 4:137718243-137718265 GAGGCAGATCCTTCATTGCTGGG - Intergenic
981066179 4:140488774-140488796 GAAGATGATCCCTCATGGCTTGG + Intronic
981194517 4:141903079-141903101 GGGGCAGATCTCTCATGGCTTGG - Intergenic
981483232 4:145259186-145259208 GAGGCAGCTCTCTCATGGCTTGG - Intergenic
981695065 4:147551615-147551637 GAGGCAGATCCCTCATGGCTTGG - Intergenic
982490749 4:156026260-156026282 GGGGCAGATCTCTCATGGCTTGG + Intergenic
982629353 4:157812444-157812466 GAGGCAGATCTCTCATAGCTTGG - Intergenic
982997287 4:162365855-162365877 GTGGCAGATGCCTCATGGCTTGG - Intergenic
984065017 4:175036973-175036995 CAGGCAGATCACTTAAGGCTGGG - Intergenic
985056062 4:186036496-186036518 GGGGTGGATCCCTTATGGCTTGG + Intergenic
985199160 4:187466531-187466553 GGGGTGGATCCCTCATGGCTTGG - Intergenic
985286568 4:188342295-188342317 AAGCCTGATCCTTTATGACTTGG + Intergenic
985436288 4:189932391-189932413 GAGGTGGATCCCTCATGGCTTGG - Intergenic
985524210 5:393863-393885 GAGGCTGATCACTTAAGGTCAGG - Intronic
985804152 5:2028215-2028237 AGGGCGGATCCCTCATGGCTTGG + Intergenic
986007508 5:3680464-3680486 CAGGCTGATCACTTGAGGCTGGG + Intergenic
986065081 5:4227604-4227626 GGGGCAGATCCCTCATGGCTTGG - Intergenic
986817987 5:11433725-11433747 GGGACAGATCCCTCATGGCTTGG - Intronic
986926943 5:12766294-12766316 GGGGCAGATCCCTCATGACTTGG + Intergenic
986949045 5:13059777-13059799 GGGGTGGATCCCTTATGCCTTGG - Intergenic
986949286 5:13061909-13061931 GGGACAGATCCCTTATGGCTTGG - Intergenic
987137438 5:14913037-14913059 CAGGCTGATCCCTTGAGGCCAGG - Intergenic
987182326 5:15380760-15380782 GGGGTGGATCCCTCATGGCTTGG + Intergenic
987213231 5:15706213-15706235 GGAGCTGATCCTTCATGGCTTGG + Intronic
987308187 5:16658140-16658162 GGGGAGGATCCCTCATGGCTTGG - Intergenic
988865561 5:35330822-35330844 AGGGAGGATCCCTTATGGCTTGG + Intergenic
988876815 5:35456171-35456193 GGGGCAGATCCCTCATGGCTTGG + Intergenic
989106391 5:37867197-37867219 GGGGCAGATCCCTCATGGCTTGG - Intergenic
989382355 5:40821982-40822004 GGGGCAGACCCCTCATGGCTTGG - Intergenic
989470119 5:41806511-41806533 GATGCAGATCCCTTATGAATTGG + Intronic
989545762 5:42671374-42671396 GGGGGTGGGCCCTTATGGCTTGG - Intronic
990427235 5:55698699-55698721 GAGGCAGATCGCTTGAGGCTGGG + Intronic
990560847 5:56981367-56981389 GAGGTGGATCCCCCATGGCTTGG + Intergenic
990706090 5:58531290-58531312 GAGGCAGACCTCTCATGGCTTGG + Intergenic
990785066 5:59409496-59409518 TGGGCAGATCCCTTATGGCTTGG + Intronic
991536021 5:67669886-67669908 GAGGCAAATCCCTTCTGCCTAGG - Intergenic
991643663 5:68779154-68779176 GGGGTGGATCCCTAATGGCTTGG - Intergenic
991776486 5:70090295-70090317 GGGGCAGATCCCTCATGGCTTGG + Intergenic
991855773 5:70965742-70965764 GGGGCAGATCCCTCATGGCTTGG + Intergenic
991869788 5:71098520-71098542 GGGGCAGATCCCTCATGGCTTGG + Intergenic
991943177 5:71874844-71874866 TAGGCTGATTCCTTATATCTGGG + Intergenic
992369487 5:76127964-76127986 GCAGCTGACTCCTTATGGCTAGG + Intronic
992781597 5:80133022-80133044 GTTGCAGATCCCTCATGGCTTGG + Intronic
993126005 5:83836326-83836348 GGGGCACATCCCTCATGGCTTGG + Intergenic
993946734 5:94124217-94124239 GGGGTGGATCCCTCATGGCTTGG - Intergenic
994209120 5:97068563-97068585 GAAGTAGATCCCTCATGGCTTGG + Intergenic
994449032 5:99917253-99917275 GGAGTGGATCCCTTATGGCTTGG + Intergenic
994500050 5:100563965-100563987 GGGACTGATCCCTCATGGCTTGG + Intronic
994520960 5:100834658-100834680 TGGGTGGATCCCTTATGGCTTGG + Intronic
994585484 5:101703789-101703811 GCGGCAGATCCCTCATTGCTTGG - Intergenic
995761192 5:115564108-115564130 GGGGCAAATCCCTCATGGCTTGG + Intergenic
995761500 5:115566487-115566509 GGGGCAGATCCCTTTTAGCTTGG + Intergenic
995911494 5:117193109-117193131 GGAGCTGATCCCTCATGGCTTGG + Intergenic
995971364 5:117974953-117974975 GAGGCAGATCCCTCATGACTGGG - Intergenic
996013243 5:118503860-118503882 GGGGTGGATCCCTCATGGCTTGG + Intergenic
996167704 5:120245423-120245445 GGGGCAGATCCCTCACGGCTTGG + Intergenic
996782834 5:127207207-127207229 GGGGCAGATCTCTTGTGGCTTGG + Intergenic
997142689 5:131399488-131399510 GGGGCAGATCCCTCATGGCTTGG - Intergenic
997246730 5:132356105-132356127 GGGGCAGATCCCTCATGGCTTGG + Intergenic
997815568 5:137014068-137014090 GAGGTGGATCCCTCATGGCTTGG + Intronic
998018413 5:138751231-138751253 GAGGAGGATCCCTCATGGCTTGG - Intronic
998325630 5:141277548-141277570 GAAGCAGATCCCTTTTGGCTTGG + Intergenic
999087829 5:148908957-148908979 GAGGCTGATCCCTTGAGCCCAGG + Intergenic
999617278 5:153437621-153437643 GAAGATGATCCCTTCTAGCTTGG - Intergenic
999632707 5:153587169-153587191 GGGGCAGATCCCTCAGGGCTTGG + Intronic
999700955 5:154227940-154227962 GAGGTGGATCCCTCATGGCTTGG + Intronic
999754092 5:154651787-154651809 GAGCCTGTTTCCTCATGGCTTGG + Intergenic
999838257 5:155397825-155397847 GGTGCAGATCCCTCATGGCTTGG - Intergenic
999900826 5:156085322-156085344 GGGGACGATCCCTCATGGCTAGG + Intronic
1000317063 5:160102467-160102489 GAGGCTGATCACTTGAGGCCAGG + Intronic
1000418155 5:161005795-161005817 GAGGAGGATCCCTCGTGGCTTGG + Intergenic
1000546403 5:162609199-162609221 GAGGTGGATCCCTTATGGCTTGG + Intergenic
1001063122 5:168511493-168511515 GGGGCAGATTCCTTATGGCTTGG - Intronic
1001418251 5:171564207-171564229 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
1002008575 5:176257580-176257602 GGGGCATATCCCTCATGGCTTGG - Intronic
1002218147 5:177654671-177654693 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1002471885 5:179440376-179440398 GGGGCAGATTCCTCATGGCTTGG - Intergenic
1003934182 6:10958439-10958461 GGGGCGGATTCCTCATGGCTTGG - Intronic
1004271512 6:14200273-14200295 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1004400972 6:15288390-15288412 GGGGTGGATCCCTCATGGCTTGG - Intronic
1004887644 6:20067091-20067113 GGGGCGGATCCCTCATGGCTTGG - Intergenic
1004918711 6:20356395-20356417 GAGGTGGATCCCTCATGGCTTGG + Intergenic
1005022454 6:21431301-21431323 GGGGTGGATCCCTCATGGCTGGG + Intergenic
1005221307 6:23591913-23591935 GGGGCAGATCCCTCTTGGCTTGG + Intergenic
1005597752 6:27395283-27395305 GAGGTAGATCCCTCGTGGCTTGG + Intronic
1006441248 6:34054923-34054945 GAGGCTGAGCCCTCATGGGTGGG - Intronic
1006657513 6:35608465-35608487 CAGGCTGATCGCTTATGCCCTGG + Intronic
1007233803 6:40375755-40375777 GAGGCAGAGCCCTTATGAATGGG + Intergenic
1007515954 6:42411585-42411607 GACTCAGATCCCTTCTGGCTAGG - Intronic
1008418563 6:51271261-51271283 GGGGTGGATCACTTATGGCTTGG + Intergenic
1008553382 6:52654712-52654734 GGGGCACATCCCTCATGGCTTGG + Intergenic
1009550029 6:65078817-65078839 CAGGCAGATCCCTCATGACTTGG + Intronic
1010525533 6:76895706-76895728 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1010618195 6:78040770-78040792 TGGGCAGATCCCTCATGGCTTGG - Intergenic
1010661298 6:78573342-78573364 AAGGCAGATCCCCCATGGCTTGG - Intergenic
1011115764 6:83889930-83889952 GGGGCAGATCTCTCATGGCTTGG - Intronic
1012130328 6:95482862-95482884 GAAGCAGATCCCTCATGGCTTGG + Intergenic
1012187060 6:96231987-96232009 GAGGCAGATCCCTCATGACTTGG - Intergenic
1012402794 6:98858128-98858150 GAAGCAGATCCCTCATGGCTTGG - Intergenic
1012769694 6:103416019-103416041 TAGGCAGATCCCTTGAGGCTGGG - Intergenic
1012809272 6:103937423-103937445 GAGGTGGATCCCTCATGTCTTGG - Intergenic
1013133885 6:107261293-107261315 GGGGCAGATCCCTTATGGCTTGG + Intronic
1013820332 6:114146692-114146714 GGGGTGGATCCCTCATGGCTTGG + Intronic
1014220251 6:118792454-118792476 GGGGCAGATTCCTTGTGGCTTGG - Intergenic
1014811884 6:125895819-125895841 GGGGCAGATCCCTCATTGCTTGG - Intronic
1014893662 6:126873052-126873074 GGGGCAGATCCCTTATGGCTTGG + Intergenic
1015087105 6:129308927-129308949 GGGGCTGATCCCTCAGGGCTTGG - Intronic
1015207796 6:130660149-130660171 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1015218963 6:130782349-130782371 GAGGCAGATCCCTCATGGCTTGG + Intergenic
1015662184 6:135588427-135588449 GGGGCAGATCCCTCATGGTTCGG - Intergenic
1015979733 6:138826784-138826806 GGGGCAGATCCCTCATGGTTTGG + Intronic
1016345722 6:143112101-143112123 GAAGGAGCTCCCTTATGGCTAGG - Intronic
1016564242 6:145434894-145434916 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1016669154 6:146681188-146681210 AAGGCAGATCCCTCATGGCTTGG + Intronic
1016912154 6:149209716-149209738 GGGGCTGATGCCTCATGACTTGG - Intergenic
1016950709 6:149577060-149577082 GGGGCAGATCCCTCATGGCTTGG - Intronic
1017189838 6:151641255-151641277 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1018322189 6:162623091-162623113 GAGGCTGAAGCCTAATGACTGGG - Intronic
1018388687 6:163327206-163327228 GGGGCAGATTCCTCATGGCTTGG + Intergenic
1018413401 6:163579420-163579442 GAGGCGGATCCCTCATGAATAGG - Intergenic
1018453660 6:163932467-163932489 GAGGCTGATCCCGTATGGAGAGG + Intergenic
1018474596 6:164127930-164127952 GAGGCAGAGCCCTTATGAATGGG - Intergenic
1018645172 6:165941546-165941568 GAGGTGGATCCCTCACGGCTTGG + Intronic
1019063255 6:169273591-169273613 GGGGCAGATCCTTCATGGCTTGG + Intergenic
1019106871 6:169675209-169675231 GGGGCAGATCCCTCATGGCATGG + Intronic
1019601433 7:1885731-1885753 GAGGCAGATCCCCGAGGGCTCGG + Intronic
1019956722 7:4420826-4420848 GGGGCGGATCCCTCATGGTTTGG + Intergenic
1020039633 7:4992204-4992226 GAGTCTGATCCCATCTGGCCTGG + Intronic
1020414089 7:7925879-7925901 GGGGCACATCCCTCATGGCTTGG + Intronic
1020630844 7:10637686-10637708 GGGGCAGATCCCTCATGTCTTGG - Intergenic
1020646573 7:10821462-10821484 GGGGCCGATCTCTTGTGGCTTGG - Intergenic
1020677290 7:11197349-11197371 GAGGATGACCCCTTCTGCCTGGG + Intergenic
1021659878 7:22909189-22909211 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1022044474 7:26612064-26612086 GGGGCGGATCTCTCATGGCTTGG + Intergenic
1022060440 7:26787781-26787803 CGGGCAGATCCCTCATGGCTTGG - Intronic
1022548312 7:31209884-31209906 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1023030993 7:36090236-36090258 GGGGCTGATCCCTCATGGTTTGG + Intergenic
1023093366 7:36636850-36636872 GAGGAAAATCCCTCATGGCTAGG - Intronic
1023391191 7:39713297-39713319 GAGGTGGATCCCTCATGGCTTGG + Intergenic
1023714858 7:43033641-43033663 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1024307994 7:47944188-47944210 GGGGCAGATCTCTCATGGCTTGG + Intronic
1024805134 7:53130471-53130493 GGGGCTGAGCCCTTATGAATGGG + Intergenic
1024926207 7:54618364-54618386 GGAGCGGATCCCTCATGGCTTGG - Intergenic
1025637821 7:63339274-63339296 GAGGCTGATGACCTTTGGCTTGG + Intergenic
1025644876 7:63408825-63408847 GAGGCTGATGACCTTTGGCTTGG - Intergenic
1025957676 7:66195322-66195344 GAGGCAGATCACTTAAGGCCAGG + Intergenic
1026530175 7:71190301-71190323 GTAGCGGATCCCTCATGGCTTGG + Intronic
1027491665 7:78834784-78834806 GGGGTGGATCCCTTATGGCTTGG + Intronic
1027513400 7:79110831-79110853 GGGGCAGATCCCTCATTGCTTGG + Intronic
1027941771 7:84691384-84691406 GAGGTGGATCCCTCATGGTTTGG + Intergenic
1030157776 7:106473432-106473454 CAGGAGGATCCCTTAAGGCTAGG + Intergenic
1030513341 7:110512420-110512442 GGGGCGGATCCCTCATGACTTGG - Intergenic
1031310726 7:120194183-120194205 GGAGCAGATCCCTCATGGCTTGG - Intergenic
1031383635 7:121118898-121118920 GGGGCGGATCCCTCGTGGCTTGG - Intronic
1031669698 7:124528037-124528059 GAGGCAGATCCCTCATAGCTTGG - Intergenic
1031798743 7:126214400-126214422 GAGGATGATCCTTCAGGGCTTGG + Intergenic
1032347446 7:131129801-131129823 CAGGATGATCCCTTGAGGCTGGG - Intronic
1032660959 7:133983205-133983227 GGGGAGGATCCCTTAGGGCTTGG - Intronic
1033028406 7:137800353-137800375 GGGGCAGATCCCTCATGGCTTGG + Intronic
1034602763 7:152278106-152278128 GGGGCAAATCCCTCATGGCTTGG + Intronic
1034621041 7:152457290-152457312 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1034710535 7:153187260-153187282 GCAGCAGATCCCTCATGGCTTGG - Intergenic
1034725645 7:153332871-153332893 GGGGCAAATCCCTCATGGCTTGG - Intergenic
1038104420 8:24416427-24416449 GAGGTCGATCCCTCATGGCTTGG + Intergenic
1038278509 8:26141781-26141803 GGGGCAGATCCCTTATGGCTTGG + Intergenic
1038460668 8:27713915-27713937 GGGGCAGCTCCCTCATGGCTTGG + Intergenic
1039535923 8:38312577-38312599 GAGGTGGATCCCACATGGCTTGG + Intronic
1039652702 8:39359472-39359494 GGGGTGGATCCCTCATGGCTTGG + Intergenic
1039671414 8:39604507-39604529 GGGGTGGATCCCTCATGGCTTGG + Intronic
1039969888 8:42312736-42312758 GAGGCTGGTGCTTTATAGCTTGG - Intronic
1040614372 8:49019813-49019835 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1040680320 8:49801144-49801166 GGGGCAGATCCCTTATGGCTTGG + Intergenic
1040984764 8:53281353-53281375 CAGGGGGATCCCTTATGGCTTGG + Intergenic
1041315942 8:56562644-56562666 GGGGCAGATCTCTCATGGCTTGG + Intergenic
1041548892 8:59078373-59078395 GGTGCAGATCCCTCATGGCTTGG + Intronic
1042247525 8:66722932-66722954 GGGGCAGATCCCTCATGGCTTGG - Intronic
1042400591 8:68341593-68341615 GTGGCAGATCCCTCATGGCTTGG + Intronic
1043116665 8:76263750-76263772 GAATCAGATCCCTTATGACTAGG - Intergenic
1043178845 8:77057996-77058018 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1043533782 8:81177683-81177705 GGGGAGGATCCCTTATGGCTTGG - Intergenic
1045011409 8:97961995-97962017 TACGCTGAGCCCATATGGCTGGG - Intronic
1045616123 8:103913830-103913852 GGGACAGATCCCTTGTGGCTTGG - Intronic
1045817597 8:106294689-106294711 GAGGCAGATCCTTCATGGCTTGG - Intronic
1046214636 8:111127356-111127378 GGGGTGGATCCCTTGTGGCTTGG - Intergenic
1046267361 8:111847733-111847755 GGGGCAGATTCCTCATGGCTTGG - Intergenic
1046680987 8:117169825-117169847 GTGCCAGATCCCTCATGGCTTGG - Intronic
1047393193 8:124470960-124470982 GGGACTGATCCCTGATGGCTTGG + Intergenic
1047458753 8:125041410-125041432 CAGGCTGATCGCTTGAGGCTAGG + Intronic
1047674477 8:127185252-127185274 CAGGCAGATCCCTTAAGTCTAGG + Intergenic
1048264803 8:132976376-132976398 GAGGCAGAGCCCTCATGGGTGGG - Intronic
1048383645 8:133890904-133890926 GGGGCAGAGCCCTTATGACTTGG + Intergenic
1048506764 8:135028663-135028685 GGGACTGATCCCTCATGGCTCGG + Intergenic
1048696051 8:137029223-137029245 GGTGCAGATCCCTTATGACTTGG - Intergenic
1051639086 9:19207671-19207693 GAGGCTGATTGCTTAAGGCCAGG - Intergenic
1052090591 9:24322011-24322033 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1053219207 9:36297658-36297680 CAGGCTGATCTCTTAAGGCCAGG + Intronic
1053724403 9:40983826-40983848 GAGGTGGATCCCTCATGGCTTGG - Intergenic
1054341565 9:63868173-63868195 GAGGTGGATCCCTCATGGCTTGG + Intergenic
1054836953 9:69685585-69685607 GGGGCAGATGCCTCATGGCTTGG + Intergenic
1054854049 9:69879027-69879049 GAGGCAGATCCCTCATGGCCTGG - Intronic
1055982202 9:82015283-82015305 GGGGCGTATCCCTCATGGCTTGG + Intergenic
1056054162 9:82803444-82803466 GGGGCAGATCCCTCGTGGCTTGG + Intergenic
1056512537 9:87319601-87319623 GGGGCAGATCCCTCATGGTTTGG - Intergenic
1056903802 9:90627004-90627026 GGGGCAGATCCCTTATGGCTTGG + Intronic
1058045733 9:100354766-100354788 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1058259923 9:102815368-102815390 GAGGCTGATGACTTTTGGTTGGG - Intergenic
1058523108 9:105831600-105831622 GGGGCAAATCCCTCATGGCTTGG - Intergenic
1059008696 9:110432964-110432986 GGGGCAGATCCCTCATGGCTTGG + Intronic
1059371585 9:113844021-113844043 CAGGTGGATCCCTCATGGCTTGG - Intergenic
1059884945 9:118735566-118735588 GGTGTGGATCCCTTATGGCTTGG + Intergenic
1059998188 9:119934076-119934098 GATGCAGATCCCTCATGGCTTGG - Intergenic
1060755783 9:126212340-126212362 GGGGCAGATCCCTCATGGTTTGG + Intergenic
1060758296 9:126228177-126228199 GAAGGTGCACCCTTATGGCTAGG - Intergenic
1060789628 9:126477247-126477269 GAGGTGGATCCCTCATGGCTTGG - Intronic
1061651508 9:132054190-132054212 GGGGCGGATCCCTCATGGCTTGG + Intronic
1062122277 9:134840135-134840157 GAGGCTGACTCCGTCTGGCTGGG - Intronic
1062145778 9:134988940-134988962 GGAGCAGATCCCTCATGGCTAGG - Intergenic
1062598570 9:137310051-137310073 CACGCTGACCCCTTAAGGCTGGG - Intronic
1203450394 Un_GL000219v1:108143-108165 GAGGTGGATCCCTCATGGCTTGG + Intergenic
1185697355 X:2205262-2205284 GAGGCAGATCCCTCATGGTTTGG - Intergenic
1185845333 X:3432560-3432582 GAGGGTGAAGCCTTATGGATGGG - Intergenic
1186552450 X:10521207-10521229 GGGGCAGATCCCTCATGGCTTGG - Intronic
1187083420 X:16015676-16015698 GGGGTGGATCCCTCATGGCTTGG - Intergenic
1188166360 X:26869668-26869690 GAGGTGGATCCCTCATGGCTTGG - Intergenic
1188381325 X:29496360-29496382 GAGACAGATCCCTCATGGCTTGG + Intronic
1188640021 X:32489354-32489376 GGGGCTAATCCCTTAGGGATTGG + Intronic
1188903093 X:35759385-35759407 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1188997351 X:36902142-36902164 GCAGAAGATCCCTTATGGCTTGG - Intergenic
1189070308 X:37856607-37856629 GGGGCAGATCTCTCATGGCTTGG - Intronic
1189267577 X:39728659-39728681 GGGGCAGATCCCTCATGCCTTGG + Intergenic
1189353032 X:40291337-40291359 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1189707411 X:43772756-43772778 GGGACGGATCCCTCATGGCTTGG + Intronic
1189886342 X:45548207-45548229 GGGGCAGATCCCTCATAGCTTGG - Intergenic
1190103190 X:47538772-47538794 GGGGCAGATCCTTCATGGCTTGG + Intergenic
1190479295 X:50859930-50859952 GGGGCAGATCCCTCACGGCTTGG + Intergenic
1190526031 X:51330931-51330953 AGGGCGGATCCCTCATGGCTTGG - Intergenic
1190543438 X:51500739-51500761 AGGGCGGATCCCTCATGGCTTGG + Intergenic
1190627659 X:52352292-52352314 CAGGATGATCCCTTGTGGCCAGG - Intergenic
1190661599 X:52659530-52659552 GGGGCAGATCCCTTGAGGCTAGG - Intronic
1191186787 X:57621493-57621515 GAGGCTGATGACTTTTGGATGGG - Intergenic
1192150139 X:68706986-68707008 GAGGCTGGTCCCTCAAGGCAGGG - Intronic
1192670759 X:73138352-73138374 GGGGCAGATCCCTTATGACTTGG - Intergenic
1193271410 X:79533905-79533927 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1193498709 X:82244860-82244882 GAGGTGAATCCCTCATGGCTTGG - Intergenic
1193724683 X:85025253-85025275 GGGGCAGATCCCTTATGGCTTGG - Intronic
1193724960 X:85027286-85027308 GCAGCAGATCCCTCATGGCTTGG - Intronic
1196278892 X:113799650-113799672 GGGGCAGATCCCTCATGACTTGG + Intergenic
1196424047 X:115551849-115551871 GAGGCGGATCACTTGAGGCTGGG - Intergenic
1196773252 X:119316741-119316763 TCGTCTGATCTCTTATGGCTCGG - Intergenic
1196834730 X:119803531-119803553 GGGGCAGATCCCTCATGGCTTGG + Intergenic
1196835885 X:119813308-119813330 GGGGCGGATCCCTCATGGCTTGG + Intergenic
1196836821 X:119821069-119821091 GGGGCGGATCCCTCATGGCTTGG + Intergenic
1196837922 X:119830318-119830340 GGGGCAGATCCTTCATGGCTTGG + Intergenic
1196923946 X:120613268-120613290 GAGGCTGATCACTTGAGGCCAGG - Intronic
1197241025 X:124123353-124123375 TGGGCGGATCCCTCATGGCTTGG + Intronic
1197357912 X:125459366-125459388 CAAGTGGATCCCTTATGGCTTGG + Intergenic
1197667365 X:129238367-129238389 GGGGCAGATCCCTCATGGCTTGG - Intergenic
1197872107 X:131070394-131070416 GAGCCTGAGCCCTTGAGGCTGGG + Intronic
1198153430 X:133933605-133933627 AGGGCAGATCCCTCATGGCTTGG + Intronic
1198760334 X:140025838-140025860 CAGGCTGATCTCTAATGCCTGGG + Intergenic
1199053635 X:143266463-143266485 GAGGTGGATGCCTCATGGCTTGG + Intergenic
1199163117 X:144637827-144637849 GAGGCTTTTCCCTTTTTGCTTGG - Intergenic
1199261254 X:145778333-145778355 GAGGTTGATCCCTCATGGCTAGG + Intergenic
1199512577 X:148638781-148638803 GGGGCAGATCCCTCATGGCTTGG - Intronic
1199865328 X:151842942-151842964 GGGGCAGGTCCCTCATGGCTTGG + Intergenic
1200766058 Y:7081793-7081815 AGGGCAGATCCCTCATGGCTTGG - Intronic
1201222305 Y:11783688-11783710 GTGGTGGATCCCTTATGGCTTGG + Intergenic
1202300768 Y:23411480-23411502 GAGGCTGATCACTTGAGCCTAGG - Intergenic
1202570043 Y:26259118-26259140 GAGGCTGATCACTTGAGCCTAGG + Intergenic