ID: 944120744

View in Genome Browser
Species Human (GRCh38)
Location 2:196238019-196238041
Sequence CATTTTGAGGGGATTAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944120740_944120744 5 Left 944120740 2:196237991-196238013 CCAGACATGAAGAACTTACAAAA No data
Right 944120744 2:196238019-196238041 CATTTTGAGGGGATTAGAATTGG No data
944120739_944120744 6 Left 944120739 2:196237990-196238012 CCCAGACATGAAGAACTTACAAA No data
Right 944120744 2:196238019-196238041 CATTTTGAGGGGATTAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944120744 Original CRISPR CATTTTGAGGGGATTAGAAT TGG Intronic
No off target data available for this crispr