ID: 944121810

View in Genome Browser
Species Human (GRCh38)
Location 2:196248542-196248564
Sequence CTGTAGGAAAGGTGGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944121801_944121810 13 Left 944121801 2:196248506-196248528 CCTTTTCTAAAAACAACTCTAAA No data
Right 944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944121810 Original CRISPR CTGTAGGAAAGGTGGGGAAA GGG Intronic
No off target data available for this crispr