ID: 944123731

View in Genome Browser
Species Human (GRCh38)
Location 2:196269940-196269962
Sequence AGGGGTATAAATTCTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944123718_944123731 21 Left 944123718 2:196269896-196269918 CCCAGACCTCTTGAATTAAATTT No data
Right 944123731 2:196269940-196269962 AGGGGTATAAATTCTGAGAAGGG No data
944123717_944123731 22 Left 944123717 2:196269895-196269917 CCCCAGACCTCTTGAATTAAATT No data
Right 944123731 2:196269940-196269962 AGGGGTATAAATTCTGAGAAGGG No data
944123719_944123731 20 Left 944123719 2:196269897-196269919 CCAGACCTCTTGAATTAAATTTC No data
Right 944123731 2:196269940-196269962 AGGGGTATAAATTCTGAGAAGGG No data
944123722_944123731 15 Left 944123722 2:196269902-196269924 CCTCTTGAATTAAATTTCTGGGT No data
Right 944123731 2:196269940-196269962 AGGGGTATAAATTCTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944123731 Original CRISPR AGGGGTATAAATTCTGAGAA GGG Intronic
No off target data available for this crispr