ID: 944128524

View in Genome Browser
Species Human (GRCh38)
Location 2:196320487-196320509
Sequence GGCCTGTGGAAAGACGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944128524 Original CRISPR GGCCTGTGGAAAGACGGCGA AGG (reversed) Intronic
903096586 1:20981214-20981236 GGCCTCTGGAAAAACTGGGAAGG + Exonic
903446066 1:23423886-23423908 GGCCTGTGCAGCGAGGGCGAGGG - Intronic
904705450 1:32386893-32386915 GGACTGTGGGAAGACAGAGAGGG + Exonic
905882926 1:41476235-41476257 GGGCTGTGGAGAGGCTGCGAAGG + Intergenic
908543866 1:65146633-65146655 GGCCTGTGGAAGGAAGGCAGAGG + Intergenic
915030787 1:152878996-152879018 GGCCTGTGGGCAGAGGGAGAAGG + Intronic
919534938 1:198775845-198775867 GGTCTGTGGAAACAAGGCGGGGG + Intergenic
919538866 1:198824310-198824332 GTGCTGTGGAAAGAAGGAGAAGG - Intergenic
920040347 1:203091292-203091314 GGCCTTTGGAAATACGGGCAGGG + Intronic
920838707 1:209535758-209535780 AGCCTGGGGAAAGACGGGGAGGG + Intergenic
922821869 1:228490241-228490263 GGCCTGTGGATAGCAGGCAAGGG - Intronic
922862358 1:228830275-228830297 GGCCTGTGGGAAGTGGGCCAGGG + Intergenic
1062981550 10:1726882-1726904 GGCCCGGGGAAGGACAGCGAGGG + Intronic
1063952915 10:11241075-11241097 AGCCTGTAGAGTGACGGCGAAGG + Intronic
1064392447 10:14953791-14953813 AGCCTGTGGGAAGCCAGCGAGGG - Intronic
1065655283 10:27941987-27942009 GGCCCCAGGAAAGACGGGGATGG + Intronic
1068751068 10:60592942-60592964 GGCCTTTGGAAAGAAGGTTAGGG - Intronic
1070801444 10:79246668-79246690 GGCTTGGGGAAGGAGGGCGAGGG - Intronic
1072240725 10:93493289-93493311 GGCCTGTGGAAAAGCCCCGAAGG + Intergenic
1072424370 10:95317186-95317208 GGTCTTTGGAAAGAAGGTGAAGG + Intronic
1072772232 10:98151966-98151988 AGACCGTGGAAAGAGGGCGAGGG - Intronic
1076479108 10:130772713-130772735 AGCCTGGGGCAAGAGGGCGAAGG - Intergenic
1076687761 10:132205798-132205820 CGCCTGTGCAGAGACGGCGTGGG - Intergenic
1077543242 11:3157508-3157530 GGCCTGTGCCAAGACAGAGAGGG + Intronic
1081700437 11:45149124-45149146 GTCCTGGGGAGAGACAGCGATGG - Intronic
1084192368 11:67504891-67504913 GGCGCGTGGAGAGCCGGCGAGGG - Intronic
1084945148 11:72634312-72634334 GGCCTGTGGGAAGAGGAAGACGG + Intronic
1086017042 11:82181191-82181213 AGACCGTGGAAAGACGGAGAGGG - Intergenic
1087053746 11:93911330-93911352 GGCCTGGGGAAGGAAGGCAATGG - Intergenic
1089268842 11:117287278-117287300 GGCCAGTGGACAGAGGGAGAAGG - Exonic
1091726452 12:2849577-2849599 GGACAGTGGAGAGACGGGGAAGG + Intronic
1092122841 12:6056749-6056771 TTCCTGTGGAAAGAGGGCGTAGG - Intronic
1093529687 12:20146274-20146296 GGCCTGTGGAGAGGTGGGGAGGG - Intergenic
1095668393 12:44830593-44830615 GGCCTGTGGAAACAAGGACAGGG - Intronic
1103479055 12:121239207-121239229 GGGCTGGGGAAAGACGGCACCGG - Exonic
1104008771 12:124914500-124914522 GGCGTGTGGAGAGACCGCCAAGG - Exonic
1104640743 12:130465321-130465343 GCGCTGTGGAGAGAAGGCGAGGG + Intronic
1105205688 13:18221619-18221641 GGACTGGGGAAAGACAGTGAAGG + Intergenic
1110127739 13:71967953-71967975 TGCCTGTGGAAAAATGGCCACGG + Intergenic
1112730151 13:102351708-102351730 GGCCTGTGGAAAGGCCCCCATGG - Intronic
1113807680 13:113119021-113119043 GGCCTGTGGAGAGAAAGCCAAGG + Exonic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1120746178 14:88153952-88153974 TGCATGTGGATAGACGGAGAGGG - Intergenic
1122504182 14:102221213-102221235 AGCCTGGGGACAGACGGAGAGGG - Intronic
1124700817 15:31910235-31910257 GGCCTGTGGGCAGAGGACGATGG + Intergenic
1138339167 16:56277335-56277357 GGCCTGTGGAAAGAGGGAATGGG + Intronic
1141713548 16:85714171-85714193 GGGCTGGGGAGAGACGGCCACGG + Intronic
1143601564 17:7949402-7949424 GGGCTGTAGCAAGGCGGCGAGGG - Exonic
1144869905 17:18363116-18363138 GGCCTTTGGCAAGAATGCGAAGG - Intronic
1146716187 17:35089039-35089061 GGCCTGGGGAAGGACGGGAAGGG - Intronic
1148437307 17:47694363-47694385 GGCCTGAGGAACGGCGGCGGAGG - Intronic
1149361413 17:55899396-55899418 GCCCTGTGGACAGACAGTGAGGG - Intergenic
1155850741 18:30770490-30770512 TGCCTGTGGAATGATGGGGAAGG - Intergenic
1156413173 18:36856323-36856345 GACCTGTGGAATGACATCGAGGG - Intronic
1156587141 18:38443915-38443937 GGCCTGTGGTGAGAGGGCAAGGG + Intergenic
1163167358 19:15507616-15507638 GGCCCTTGGAAAGAGGGCGTGGG - Intergenic
1163440980 19:17322442-17322464 AGCCTGTGCAAAGGCGGAGAAGG - Exonic
1164052194 19:21592979-21593001 GGCCTCTGGAAAGGTGGCGTGGG - Intergenic
1165621488 19:37252092-37252114 GACCTGTGGACGGACGGGGAAGG - Intergenic
1166293740 19:41878970-41878992 GGCCTGTGGAGAGACAGGGTGGG - Exonic
1166564502 19:43755296-43755318 GGCCTGTGGAGAGACTGCCAGGG + Intergenic
929675293 2:43920764-43920786 GGACTGTGGGAAGACAGGGAAGG + Intronic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
932572603 2:72945862-72945884 GGCCTCTGGAGAGTGGGCGAGGG - Intronic
936513483 2:113167291-113167313 TGTCTGTGGACAGACGGCCAGGG - Intronic
939374797 2:141350342-141350364 GGGCAGTGAAAAGATGGCGAGGG + Intronic
942163511 2:173217265-173217287 CGCATGTGGAAAGACGGCGAAGG - Intronic
944128524 2:196320487-196320509 GGCCTGTGGAAAGACGGCGAAGG - Intronic
944966813 2:204944445-204944467 TGCCTGTGGAAAGCCAGCCAGGG - Intronic
947135583 2:226974004-226974026 AGCATGTGGAAAGGCGGTGAGGG - Intronic
947602717 2:231464514-231464536 CGCCTGTGGAAAGGCGACGACGG + Exonic
947747569 2:232516864-232516886 TGCCTGTGGAAGGATGGAGATGG + Intergenic
1172887669 20:38241927-38241949 AGCCTGTGGAGAGAAGGGGATGG + Exonic
1173382553 20:42559053-42559075 GGACTGTGGAAAGACCGTGCAGG - Intronic
1177233601 21:18356225-18356247 GGAATTTGGAAAGACGGCAATGG + Intronic
1181148545 22:20866175-20866197 GGCCTGCACACAGACGGCGAGGG + Intronic
1184663958 22:45977830-45977852 GGCCTGTGGAAGGAGGTTGAGGG + Intergenic
950375653 3:12570135-12570157 GGACTGTGGAAAGCTGGGGAGGG - Exonic
950493850 3:13322085-13322107 GCCCTCTGGACAGACGGCCATGG + Intronic
950767773 3:15286211-15286233 GGCCTGTGGAAGGATGGGAATGG + Intronic
953022752 3:39126241-39126263 GGGCTGTGGGAACACGGCGGTGG - Exonic
960773884 3:121226604-121226626 GGACTGGGGAAAGAGGGCTAGGG + Intronic
967035640 3:185646696-185646718 GGCCTGAGGAGAGAGGGTGAGGG + Intronic
969148309 4:5143645-5143667 GGCCTGTGGAAAGACAGTGGAGG - Intronic
970583665 4:17495180-17495202 GGACTGTGGCATGACGGGGATGG + Intronic
976763590 4:88576269-88576291 GGCACCTGGAAAGACGGCAAGGG - Intronic
977536706 4:98261902-98261924 GGCCTCTGGAGAAACGGGGATGG - Intronic
980695903 4:136355228-136355250 GGCGTGAGGAAATACGGAGAGGG - Intergenic
985745668 5:1645424-1645446 GCCCTGTGGAAAGCTGGCGAAGG + Intergenic
986034838 5:3927605-3927627 GGCCTATGGGAAGAGGGCCATGG - Intergenic
987292365 5:16520900-16520922 AGCCTCTGGAAACACGGAGAGGG + Intronic
988461243 5:31439874-31439896 GGCCTGAGCAAAGACAGCAAAGG + Intronic
988521599 5:31950300-31950322 GCCCTGTGGAAGGACTGAGAAGG + Intronic
999254682 5:150203679-150203701 GGCCTGTGGGTAGACGACAAAGG - Exonic
999598408 5:153232713-153232735 GGCCTGTGGAAACTCGATGAAGG + Intergenic
1001415725 5:171543778-171543800 GGCCTGTGGAAACACAGCAAAGG + Intergenic
1001982345 5:176045861-176045883 GGCCTGTGGCACGACGGCGGTGG + Intergenic
1002235116 5:177798196-177798218 GGCCTGTGGCACGACGGCGGTGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1005915744 6:30349247-30349269 GGGCTGTGGAAAGAGGAAGAGGG - Intergenic
1007521530 6:42454064-42454086 GGACTGAGGAAAGAGGGCGGGGG - Intergenic
1007849253 6:44788329-44788351 GGCTTGTGGAAAGGAGGAGATGG - Intergenic
1011527206 6:88277822-88277844 GCCCTGTGGAAACAGGGCTAAGG - Intergenic
1013725592 6:113091659-113091681 TGCCTATGGAAAGATGGGGATGG + Intergenic
1017599962 6:156069701-156069723 GGCCTCTAGAAAGACGGGGATGG + Intergenic
1019073909 6:169371428-169371450 GTCCTGGAGAAGGACGGCGAGGG - Intergenic
1019153351 6:170023444-170023466 GGCCTGAGGAGAGCCGGAGAAGG - Intergenic
1019563407 7:1668675-1668697 GGCCTGTGGAACGAGGCCGGCGG - Intergenic
1020209699 7:6149397-6149419 GGCCTGTGGAAAGTATGCGCGGG + Intronic
1022822198 7:33972819-33972841 GGCCTTTGGAATTAAGGCGAGGG - Intronic
1027616812 7:80433937-80433959 GGACTGTTGAAAGATGGTGAAGG - Intronic
1029279284 7:99426202-99426224 AGACTGTGGAAAGAGGGAGAGGG - Intronic
1032836732 7:135681855-135681877 GGACTGTGGAAAGGCGGGAAAGG + Intronic
1034393713 7:150804342-150804364 GGCCTGGGGACAGAGGGCCAAGG - Exonic
1035029481 7:155848231-155848253 GGCCTGTGGGAAGAAGGCCCTGG + Intergenic
1035609075 8:948431-948453 GGCCTGAGGAAGGAAGGGGAAGG - Intergenic
1049620504 8:143596321-143596343 GGCATGTGGTGAGAAGGCGAAGG + Intronic
1050534760 9:6622272-6622294 GGCCCGTGGAAAGAGGGAGAGGG - Intronic
1055096360 9:72418442-72418464 GGCCTGTGGAAAGACAACTGGGG + Intergenic
1060036429 9:120259901-120259923 GGCCTGGGGAGAGAAGGAGATGG - Intergenic
1060452721 9:123758213-123758235 GGCCTGTGGAATCAGCGCGAGGG - Intronic
1062483542 9:136763303-136763325 GGCCTGTGGGAAGTTGGGGAGGG + Intronic
1185968582 X:4635833-4635855 GGACTGTGGAAAGATTGTGAGGG - Intergenic
1186134922 X:6509036-6509058 GGAATGTGGAAAGAGGGAGAGGG + Intergenic
1189271940 X:39758099-39758121 GGACTGTGGAAAGATGGAGCTGG - Intergenic
1192141012 X:68647353-68647375 GGCCTGTGGAAAGAGTGCCAAGG - Intergenic
1195711519 X:107776675-107776697 GGACTGAGGAGAGACGGCGAAGG - Intronic
1197833724 X:130672567-130672589 GCTCTGTGTAAAGACGGGGAGGG - Intronic
1199493481 X:148426987-148427009 GGCCTGTGGGAAGACAGACAAGG + Intergenic
1199969663 X:152850245-152850267 GGCCTGTGGAAAGAGAGGAACGG - Exonic
1200684562 Y:6246884-6246906 TGGCTGTGGAAAGGCGGAGAAGG + Intronic
1201423027 Y:13820346-13820368 GCCCTGTGGAAAGACAGCTAAGG + Intergenic