ID: 944131046

View in Genome Browser
Species Human (GRCh38)
Location 2:196347764-196347786
Sequence GACAAGCACCATGGTTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944131046_944131052 20 Left 944131046 2:196347764-196347786 CCTTGCCAACCATGGTGCTTGTC No data
Right 944131052 2:196347807-196347829 AATATTCTGGTTATTCTAGATGG No data
944131046_944131049 7 Left 944131046 2:196347764-196347786 CCTTGCCAACCATGGTGCTTGTC No data
Right 944131049 2:196347794-196347816 AGACCCTCAAGTTAATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944131046 Original CRISPR GACAAGCACCATGGTTGGCA AGG (reversed) Intronic
No off target data available for this crispr