ID: 944131047

View in Genome Browser
Species Human (GRCh38)
Location 2:196347769-196347791
Sequence TACTTGACAAGCACCATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944131047_944131052 15 Left 944131047 2:196347769-196347791 CCAACCATGGTGCTTGTCAAGTA No data
Right 944131052 2:196347807-196347829 AATATTCTGGTTATTCTAGATGG No data
944131047_944131049 2 Left 944131047 2:196347769-196347791 CCAACCATGGTGCTTGTCAAGTA No data
Right 944131049 2:196347794-196347816 AGACCCTCAAGTTAATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944131047 Original CRISPR TACTTGACAAGCACCATGGT TGG (reversed) Intronic
No off target data available for this crispr