ID: 944131049

View in Genome Browser
Species Human (GRCh38)
Location 2:196347794-196347816
Sequence AGACCCTCAAGTTAATATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944131048_944131049 -2 Left 944131048 2:196347773-196347795 CCATGGTGCTTGTCAAGTAAGAG No data
Right 944131049 2:196347794-196347816 AGACCCTCAAGTTAATATTCTGG No data
944131046_944131049 7 Left 944131046 2:196347764-196347786 CCTTGCCAACCATGGTGCTTGTC No data
Right 944131049 2:196347794-196347816 AGACCCTCAAGTTAATATTCTGG No data
944131047_944131049 2 Left 944131047 2:196347769-196347791 CCAACCATGGTGCTTGTCAAGTA No data
Right 944131049 2:196347794-196347816 AGACCCTCAAGTTAATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944131049 Original CRISPR AGACCCTCAAGTTAATATTC TGG Intronic
No off target data available for this crispr