ID: 944131341 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:196350550-196350572 |
Sequence | GAGCAATCACAGCAATGCTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
944131336_944131341 | 22 | Left | 944131336 | 2:196350505-196350527 | CCACATTTTGAAAAATTCTGCTT | No data | ||
Right | 944131341 | 2:196350550-196350572 | GAGCAATCACAGCAATGCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
944131341 | Original CRISPR | GAGCAATCACAGCAATGCTG TGG | Intronic | ||