ID: 944131341

View in Genome Browser
Species Human (GRCh38)
Location 2:196350550-196350572
Sequence GAGCAATCACAGCAATGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944131336_944131341 22 Left 944131336 2:196350505-196350527 CCACATTTTGAAAAATTCTGCTT No data
Right 944131341 2:196350550-196350572 GAGCAATCACAGCAATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944131341 Original CRISPR GAGCAATCACAGCAATGCTG TGG Intronic