ID: 944131475 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:196352217-196352239 |
| Sequence | CCTCTTAGCAGGTGGCCTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 944131475_944131482 | -3 | Left | 944131475 | 2:196352217-196352239 | CCACCAGGCCACCTGCTAAGAGG | No data | ||
| Right | 944131482 | 2:196352237-196352259 | AGGGCACCTACTGGCGACTACGG | No data | ||||
| 944131475_944131484 | 17 | Left | 944131475 | 2:196352217-196352239 | CCACCAGGCCACCTGCTAAGAGG | No data | ||
| Right | 944131484 | 2:196352257-196352279 | CGGCTTTGAAGCCACTTGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 944131475 | Original CRISPR | CCTCTTAGCAGGTGGCCTGG TGG (reversed) | Intronic | ||