ID: 944131482

View in Genome Browser
Species Human (GRCh38)
Location 2:196352237-196352259
Sequence AGGGCACCTACTGGCGACTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944131475_944131482 -3 Left 944131475 2:196352217-196352239 CCACCAGGCCACCTGCTAAGAGG No data
Right 944131482 2:196352237-196352259 AGGGCACCTACTGGCGACTACGG No data
944131478_944131482 -6 Left 944131478 2:196352220-196352242 CCAGGCCACCTGCTAAGAGGGCA No data
Right 944131482 2:196352237-196352259 AGGGCACCTACTGGCGACTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944131482 Original CRISPR AGGGCACCTACTGGCGACTA CGG Intronic