ID: 944131484

View in Genome Browser
Species Human (GRCh38)
Location 2:196352257-196352279
Sequence CGGCTTTGAAGCCACTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944131479_944131484 9 Left 944131479 2:196352225-196352247 CCACCTGCTAAGAGGGCACCTAC No data
Right 944131484 2:196352257-196352279 CGGCTTTGAAGCCACTTGAATGG No data
944131483_944131484 -9 Left 944131483 2:196352243-196352265 CCTACTGGCGACTACGGCTTTGA No data
Right 944131484 2:196352257-196352279 CGGCTTTGAAGCCACTTGAATGG No data
944131478_944131484 14 Left 944131478 2:196352220-196352242 CCAGGCCACCTGCTAAGAGGGCA No data
Right 944131484 2:196352257-196352279 CGGCTTTGAAGCCACTTGAATGG No data
944131480_944131484 6 Left 944131480 2:196352228-196352250 CCTGCTAAGAGGGCACCTACTGG No data
Right 944131484 2:196352257-196352279 CGGCTTTGAAGCCACTTGAATGG No data
944131475_944131484 17 Left 944131475 2:196352217-196352239 CCACCAGGCCACCTGCTAAGAGG No data
Right 944131484 2:196352257-196352279 CGGCTTTGAAGCCACTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944131484 Original CRISPR CGGCTTTGAAGCCACTTGAA TGG Intronic