ID: 944133379

View in Genome Browser
Species Human (GRCh38)
Location 2:196370828-196370850
Sequence AGGGAGAATGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944133379_944133386 23 Left 944133379 2:196370828-196370850 CCCACAATCACTGCATTCTCCCT No data
Right 944133386 2:196370874-196370896 TCTGTGCCACTTGCTGCTGCTGG No data
944133379_944133387 26 Left 944133379 2:196370828-196370850 CCCACAATCACTGCATTCTCCCT No data
Right 944133387 2:196370877-196370899 GTGCCACTTGCTGCTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944133379 Original CRISPR AGGGAGAATGCAGTGATTGT GGG (reversed) Intronic
No off target data available for this crispr