ID: 944139199

View in Genome Browser
Species Human (GRCh38)
Location 2:196436782-196436804
Sequence CACAGGGAAAGGGCTATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944139199_944139206 -6 Left 944139199 2:196436782-196436804 CCTAACATAGCCCTTTCCCTGTG No data
Right 944139206 2:196436799-196436821 CCTGTGGGAACTTGAAATTTTGG No data
944139199_944139207 -5 Left 944139199 2:196436782-196436804 CCTAACATAGCCCTTTCCCTGTG No data
Right 944139207 2:196436800-196436822 CTGTGGGAACTTGAAATTTTGGG No data
944139199_944139208 -4 Left 944139199 2:196436782-196436804 CCTAACATAGCCCTTTCCCTGTG No data
Right 944139208 2:196436801-196436823 TGTGGGAACTTGAAATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944139199 Original CRISPR CACAGGGAAAGGGCTATGTT AGG (reversed) Intronic
No off target data available for this crispr