ID: 944140072

View in Genome Browser
Species Human (GRCh38)
Location 2:196446504-196446526
Sequence CTGGACCTACATGGTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944140070_944140072 -8 Left 944140070 2:196446489-196446511 CCTCTAAGTTGGCAGCTGGACCT No data
Right 944140072 2:196446504-196446526 CTGGACCTACATGGTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944140072 Original CRISPR CTGGACCTACATGGTTTTCT TGG Intronic
No off target data available for this crispr