ID: 944140372

View in Genome Browser
Species Human (GRCh38)
Location 2:196449867-196449889
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944140372_944140376 -2 Left 944140372 2:196449867-196449889 CCCACCCTTTGCAATGGTGTGAT No data
Right 944140376 2:196449888-196449910 ATTCCTTCAGTCATAATGCATGG No data
944140372_944140379 6 Left 944140372 2:196449867-196449889 CCCACCCTTTGCAATGGTGTGAT No data
Right 944140379 2:196449896-196449918 AGTCATAATGCATGGGAAACAGG No data
944140372_944140377 -1 Left 944140372 2:196449867-196449889 CCCACCCTTTGCAATGGTGTGAT No data
Right 944140377 2:196449889-196449911 TTCCTTCAGTCATAATGCATGGG No data
944140372_944140380 24 Left 944140372 2:196449867-196449889 CCCACCCTTTGCAATGGTGTGAT No data
Right 944140380 2:196449914-196449936 ACAGGAATAAAGAAGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944140372 Original CRISPR ATCACACCATTGCAAAGGGT GGG (reversed) Intronic
No off target data available for this crispr