ID: 944140377

View in Genome Browser
Species Human (GRCh38)
Location 2:196449889-196449911
Sequence TTCCTTCAGTCATAATGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944140374_944140377 -5 Left 944140374 2:196449871-196449893 CCCTTTGCAATGGTGTGATTCCT No data
Right 944140377 2:196449889-196449911 TTCCTTCAGTCATAATGCATGGG No data
944140373_944140377 -2 Left 944140373 2:196449868-196449890 CCACCCTTTGCAATGGTGTGATT No data
Right 944140377 2:196449889-196449911 TTCCTTCAGTCATAATGCATGGG No data
944140375_944140377 -6 Left 944140375 2:196449872-196449894 CCTTTGCAATGGTGTGATTCCTT No data
Right 944140377 2:196449889-196449911 TTCCTTCAGTCATAATGCATGGG No data
944140372_944140377 -1 Left 944140372 2:196449867-196449889 CCCACCCTTTGCAATGGTGTGAT No data
Right 944140377 2:196449889-196449911 TTCCTTCAGTCATAATGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944140377 Original CRISPR TTCCTTCAGTCATAATGCAT GGG Intronic
No off target data available for this crispr