ID: 944140378

View in Genome Browser
Species Human (GRCh38)
Location 2:196449891-196449913
Sequence TTCCCATGCATTATGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944140378_944140380 0 Left 944140378 2:196449891-196449913 CCTTCAGTCATAATGCATGGGAA No data
Right 944140380 2:196449914-196449936 ACAGGAATAAAGAAGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944140378 Original CRISPR TTCCCATGCATTATGACTGA AGG (reversed) Intronic
No off target data available for this crispr