ID: 944140379

View in Genome Browser
Species Human (GRCh38)
Location 2:196449896-196449918
Sequence AGTCATAATGCATGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944140372_944140379 6 Left 944140372 2:196449867-196449889 CCCACCCTTTGCAATGGTGTGAT No data
Right 944140379 2:196449896-196449918 AGTCATAATGCATGGGAAACAGG No data
944140373_944140379 5 Left 944140373 2:196449868-196449890 CCACCCTTTGCAATGGTGTGATT No data
Right 944140379 2:196449896-196449918 AGTCATAATGCATGGGAAACAGG No data
944140374_944140379 2 Left 944140374 2:196449871-196449893 CCCTTTGCAATGGTGTGATTCCT No data
Right 944140379 2:196449896-196449918 AGTCATAATGCATGGGAAACAGG No data
944140375_944140379 1 Left 944140375 2:196449872-196449894 CCTTTGCAATGGTGTGATTCCTT No data
Right 944140379 2:196449896-196449918 AGTCATAATGCATGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944140379 Original CRISPR AGTCATAATGCATGGGAAAC AGG Intronic
No off target data available for this crispr