ID: 944140380

View in Genome Browser
Species Human (GRCh38)
Location 2:196449914-196449936
Sequence ACAGGAATAAAGAAGAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944140372_944140380 24 Left 944140372 2:196449867-196449889 CCCACCCTTTGCAATGGTGTGAT No data
Right 944140380 2:196449914-196449936 ACAGGAATAAAGAAGAGACTTGG No data
944140378_944140380 0 Left 944140378 2:196449891-196449913 CCTTCAGTCATAATGCATGGGAA No data
Right 944140380 2:196449914-196449936 ACAGGAATAAAGAAGAGACTTGG No data
944140374_944140380 20 Left 944140374 2:196449871-196449893 CCCTTTGCAATGGTGTGATTCCT No data
Right 944140380 2:196449914-196449936 ACAGGAATAAAGAAGAGACTTGG No data
944140375_944140380 19 Left 944140375 2:196449872-196449894 CCTTTGCAATGGTGTGATTCCTT No data
Right 944140380 2:196449914-196449936 ACAGGAATAAAGAAGAGACTTGG No data
944140373_944140380 23 Left 944140373 2:196449868-196449890 CCACCCTTTGCAATGGTGTGATT No data
Right 944140380 2:196449914-196449936 ACAGGAATAAAGAAGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944140380 Original CRISPR ACAGGAATAAAGAAGAGACT TGG Intronic
No off target data available for this crispr