ID: 944141632

View in Genome Browser
Species Human (GRCh38)
Location 2:196463062-196463084
Sequence CTAAGTGGCAATTAGTCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944141629_944141632 27 Left 944141629 2:196463012-196463034 CCAGGGCTTCTGAGTCTTGGTAG No data
Right 944141632 2:196463062-196463084 CTAAGTGGCAATTAGTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944141632 Original CRISPR CTAAGTGGCAATTAGTCATA GGG Intronic
No off target data available for this crispr