ID: 944142042 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:196467347-196467369 |
| Sequence | AACTGCTTGGTATAGGATGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 944142038_944142042 | -2 | Left | 944142038 | 2:196467326-196467348 | CCTCTACAGAATCTGGAATCAAA | No data | ||
| Right | 944142042 | 2:196467347-196467369 | AACTGCTTGGTATAGGATGAGGG | No data | ||||
| 944142036_944142042 | 26 | Left | 944142036 | 2:196467298-196467320 | CCACTACTGCTATTCTTAGTATT | No data | ||
| Right | 944142042 | 2:196467347-196467369 | AACTGCTTGGTATAGGATGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 944142042 | Original CRISPR | AACTGCTTGGTATAGGATGA GGG | Intronic | ||
| No off target data available for this crispr | |||||