ID: 944142042

View in Genome Browser
Species Human (GRCh38)
Location 2:196467347-196467369
Sequence AACTGCTTGGTATAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944142038_944142042 -2 Left 944142038 2:196467326-196467348 CCTCTACAGAATCTGGAATCAAA No data
Right 944142042 2:196467347-196467369 AACTGCTTGGTATAGGATGAGGG No data
944142036_944142042 26 Left 944142036 2:196467298-196467320 CCACTACTGCTATTCTTAGTATT No data
Right 944142042 2:196467347-196467369 AACTGCTTGGTATAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944142042 Original CRISPR AACTGCTTGGTATAGGATGA GGG Intronic
No off target data available for this crispr