ID: 944143421

View in Genome Browser
Species Human (GRCh38)
Location 2:196481246-196481268
Sequence GGAATGTCACAATTTTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944143418_944143421 9 Left 944143418 2:196481214-196481236 CCACAAACTTGTTTATCTTTCTA No data
Right 944143421 2:196481246-196481268 GGAATGTCACAATTTTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944143421 Original CRISPR GGAATGTCACAATTTTAGCT TGG Intronic
No off target data available for this crispr