ID: 944153985

View in Genome Browser
Species Human (GRCh38)
Location 2:196592625-196592647
Sequence GTTTGGTTCTCCAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944153985_944153989 -6 Left 944153985 2:196592625-196592647 CCAGTTTCCCTGGAGAACCAAAC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 944153989 2:196592642-196592664 CCAAACCATCCAACACATCCTGG 0: 1
1: 0
2: 2
3: 12
4: 133
944153985_944153990 -5 Left 944153985 2:196592625-196592647 CCAGTTTCCCTGGAGAACCAAAC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 944153990 2:196592643-196592665 CAAACCATCCAACACATCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 129
944153985_944153992 1 Left 944153985 2:196592625-196592647 CCAGTTTCCCTGGAGAACCAAAC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 944153992 2:196592649-196592671 ATCCAACACATCCTGGGCAGCGG 0: 1
1: 0
2: 0
3: 12
4: 121
944153985_944153995 13 Left 944153985 2:196592625-196592647 CCAGTTTCCCTGGAGAACCAAAC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 944153995 2:196592661-196592683 CTGGGCAGCGGAAACCGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944153985 Original CRISPR GTTTGGTTCTCCAGGGAAAC TGG (reversed) Intronic
902191804 1:14768850-14768872 GTTTGCTTTTCAAGGGAAGCCGG + Intronic
902434921 1:16392301-16392323 GTTTGGTTCTGAAGAGAAGCTGG + Intronic
902581406 1:17410043-17410065 GTTTGCTTCGCCAGGGCTACGGG - Exonic
904266400 1:29320670-29320692 GTGTAGCTCTGCAGGGAAACCGG - Exonic
905262555 1:36729919-36729941 CTGTGGTTCTCCAGGGAGCCAGG - Intergenic
905422678 1:37859347-37859369 GTCCGGGTCTCCATGGAAACAGG + Intronic
905425596 1:37881421-37881443 GTGTGGTGCTCCAGGGAAGAGGG - Intronic
905475486 1:38224225-38224247 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
906447355 1:45913888-45913910 GTTGGGGTCTCTATGGAAACTGG + Intronic
908760144 1:67504103-67504125 GAATGTTTCTCCAGGGAATCAGG + Intergenic
911400840 1:97373215-97373237 GTATATTGCTCCAGGGAAACTGG + Intronic
911902777 1:103526052-103526074 TTTTGCTTCTCCAAGGAAAATGG + Exonic
912561988 1:110557590-110557612 GGTCAGTTTTCCAGGGAAACAGG + Intergenic
914949710 1:152101946-152101968 GTAAGGTGCTCCAGGGAAAAAGG + Intergenic
914953523 1:152140923-152140945 GCTTGGTTCTCAAAGAAAACAGG + Intergenic
915209946 1:154301044-154301066 GATTGGTTCTCCCTGGAAACAGG - Intergenic
924407487 1:243765611-243765633 GTTTGGTTAACAAGGGAATCAGG - Intronic
924947720 1:248857543-248857565 GTATGGCTCTCCAGGGTAAGAGG - Intronic
1063028979 10:2212378-2212400 ATTTGGTTGTCAAGGGAGACAGG + Intergenic
1063454586 10:6174264-6174286 GTCTGCTTCTCCTGGTAAACAGG - Intronic
1063959351 10:11293972-11293994 GTTTGGTTCTTGAGGGATCCAGG - Intronic
1066095886 10:32071807-32071829 GATTGCTTCTTAAGGGAAACAGG - Intergenic
1066266539 10:33781352-33781374 GTTTCTTTCTACAGGGAAAATGG - Intergenic
1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG + Intronic
1067690276 10:48497327-48497349 GTGGGGTTCTCCAGGGCAGCTGG + Intronic
1069943065 10:71968610-71968632 TATTGGTTCTCCATGGCAACAGG + Intronic
1072032996 10:91539169-91539191 CCCTGGTTTTCCAGGGAAACAGG - Intergenic
1072196038 10:93118045-93118067 GTTTTGTTTTCCAGGGCAAAGGG - Intergenic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1078306466 11:10192883-10192905 GTTTGGTTCTCCAGATTTACTGG - Intronic
1078467589 11:11561708-11561730 GTGTGGTTTCCCAGGGAAACAGG + Intronic
1078802178 11:14658027-14658049 GATAGGCTCTCCAGGCAAACAGG - Intronic
1078944087 11:16044184-16044206 ATTTGGGTTTCCTGGGAAACAGG - Intronic
1081219519 11:40442622-40442644 GTGTGATTCTCCAGGGAGACAGG + Intronic
1082251347 11:49984269-49984291 GTTTGTATCTGCAGGGAAATAGG - Intergenic
1082558366 11:54589738-54589760 GTTTGTGTCTGCAGGGAAATAGG + Intergenic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1084859250 11:72007384-72007406 GGCTGGTTCTCCAGGGACGCTGG + Exonic
1084944789 11:72632747-72632769 GCTGGATTCTCCAGTGAAACTGG - Intronic
1086451257 11:86919248-86919270 GTCTGGTTCCCAAGGAAAACAGG - Intronic
1087405203 11:97721848-97721870 GTATAGTTCTCCAGGGAAGTGGG - Intergenic
1088183691 11:107140298-107140320 TTCTGGTTCTCCAGGGGAAGTGG - Intergenic
1088885237 11:114000990-114001012 GTTTGGTTCCCCGGAGACACAGG + Intergenic
1091262683 11:134246437-134246459 GATTGGTTCTTCAGGGAACCAGG - Exonic
1091761581 12:3090878-3090900 GATGGGTCATCCAGGGAAACTGG + Intronic
1097087235 12:56477567-56477589 GTTCAGCTCTCCAGGGAGACTGG - Exonic
1097617978 12:61906695-61906717 GTTTGGATCTTCCTGGAAACTGG + Intronic
1098029861 12:66242548-66242570 GCTGGGTTCTCCAGGGAGAAGGG + Intronic
1098042836 12:66369681-66369703 GTTCTGTTCCCCAGAGAAACAGG - Intronic
1100145651 12:91674438-91674460 GCATGGTTCTCCAGGGGAGCTGG + Intergenic
1103444783 12:120987521-120987543 TTCTGGTGCTGCAGGGAAACAGG + Intronic
1104979868 12:132569056-132569078 TTTTGTTTCTCCTGCGAAACTGG + Intronic
1107602273 13:42025503-42025525 GTTTGTTTTTCAAGGGAAAATGG + Intergenic
1109443353 13:62402091-62402113 GCTTTGTGCACCAGGGAAACAGG + Intergenic
1115764107 14:36605068-36605090 GTTTTGCTTTCTAGGGAAACTGG - Intergenic
1118113681 14:62750888-62750910 GCTTTGTGCACCAGGGAAACAGG - Intronic
1118690340 14:68332712-68332734 GTTTTTTTCTTCAGGGAAAGAGG - Intronic
1120395065 14:83957771-83957793 GCTTTGTACACCAGGGAAACAGG + Intergenic
1120827051 14:88965627-88965649 GAAGGGTGCTCCAGGGAAACAGG + Intergenic
1122928761 14:104923755-104923777 GTTGGGTCCTCCAGGGACTCTGG - Intergenic
1202905807 14_GL000194v1_random:71928-71950 GTTGAGTTCTCCGTGGAAACTGG - Intergenic
1127992536 15:64131407-64131429 CTTTGGTTCTCCAGGGATATTGG + Intronic
1128417669 15:67461624-67461646 CCTTGGTTCTCAAAGGAAACAGG - Intronic
1128753950 15:70168670-70168692 GTTTGGTTCGGCAAGTAAACTGG - Intergenic
1131874298 15:96788228-96788250 GTGTGGTTCACCAGGGAGTCTGG - Intergenic
1132279948 15:100603436-100603458 TTTTGTTTTTCCTGGGAAACTGG - Intronic
1133030724 16:3009818-3009840 ATTGGGTCCTCCAGGGAAACCGG - Intergenic
1133321741 16:4918371-4918393 GTCTCATTCTCCAGGGAAGCTGG + Intronic
1135400772 16:22164900-22164922 CTTTGGTACTCCATGGAAACTGG + Intergenic
1136006586 16:27334513-27334535 GTAAAGTCCTCCAGGGAAACAGG - Intronic
1137637803 16:50002310-50002332 GTTTGGTTCACCAAGGCACCTGG - Intergenic
1137834532 16:51578295-51578317 GTTTGGCTCTCATGGGAAAATGG - Intergenic
1139354488 16:66359503-66359525 GTCAGGTTCTCCAGGGAAGAGGG - Intergenic
1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG + Intergenic
1143930244 17:10415137-10415159 CTTTGGTACTACAGGGAAGCTGG - Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1144768530 17:17746151-17746173 GATTCCTTCTCCAGGGACACGGG + Intronic
1148837041 17:50470736-50470758 GGTGGCTGCTCCAGGGAAACGGG + Intronic
1149292904 17:55234489-55234511 GTTGGGTTCTCCTGGAAAATAGG + Intergenic
1150280689 17:63928298-63928320 CCTTGGTTCTCCAGGCAAACTGG - Intergenic
1151149709 17:72074565-72074587 GTTTGGTTCTCCAAGGCAGCAGG + Intergenic
1151183026 17:72343395-72343417 GTTTGCTTCTCCCGGGAGCCTGG - Intergenic
1151259964 17:72908547-72908569 GGCTGGTTCTCCATGAAAACAGG + Intronic
1152775344 17:82198052-82198074 TCAGGGTTCTCCAGGGAAACAGG - Intronic
1153555725 18:6311233-6311255 TTAGGGTTCTCCAGAGAAACAGG - Intronic
1155503338 18:26508536-26508558 GTTTCTTTCTCCAGTGAAAGAGG - Intronic
1156620195 18:38842608-38842630 GTTTGGTTTTTCAGGGAGATCGG - Intergenic
1157387089 18:47266455-47266477 GTCTGCTTCCCCAGGTAAACTGG - Intergenic
1159681082 18:71353195-71353217 TTTTCGTTGTCCTGGGAAACTGG + Intergenic
1160612108 18:80096621-80096643 CTGTGGATCACCAGGGAAACTGG + Exonic
1161405838 19:4090701-4090723 GTGTGGTTCTGCAAGGAAAGGGG + Exonic
1161562591 19:4981640-4981662 GGTGGGTTCTCCAGGGGAGCAGG + Intronic
1166538566 19:43591410-43591432 GTTTAGTCCTCCAGGGAGGCTGG - Exonic
1166739121 19:45103606-45103628 GCTTGGTTCCCCAGGACAACAGG + Intronic
1168162586 19:54521527-54521549 GTGTGGTTCTCCTGGAAAATGGG - Intergenic
928856473 2:35808607-35808629 GTTAGGTTTTCCAAGGAGACTGG + Intergenic
928934035 2:36655987-36656009 GAATGGTTCACCAGGGAAACAGG + Intergenic
929078266 2:38096240-38096262 GTTTGTTTTTCCAGGGAATTGGG - Intronic
930787896 2:55288894-55288916 GTTTGCTTCTCAAGGTATACTGG + Exonic
932754944 2:74400958-74400980 GTTTAGTACTCCTGGGAACCCGG + Intergenic
934500799 2:94858575-94858597 GTTGAGTTCTCCATGGAAACTGG + Intergenic
935631643 2:105217009-105217031 TCAAGGTTCTCCAGGGAAACAGG + Intergenic
936784644 2:116079360-116079382 GTTTGCTTCTTTAGTGAAACTGG - Intergenic
937123251 2:119455299-119455321 GTTTGTCTCTCAAGGGACACTGG - Intronic
938143025 2:128812063-128812085 GAATGGTTCTCCACGGAAGCTGG - Intergenic
938880476 2:135581271-135581293 CTGTGGATCTACAGGGAAACAGG - Intronic
939446288 2:142313768-142313790 ATTGGGTTCTCAAAGGAAACTGG + Intergenic
944153985 2:196592625-196592647 GTTTGGTTCTCCAGGGAAACTGG - Intronic
948008612 2:234632462-234632484 CTTTGGTTCTCAGGTGAAACCGG - Intergenic
948649202 2:239429305-239429327 TTTTGGTTCTCCTAGGAAAAAGG + Intergenic
1170096635 20:12652447-12652469 GCTTGGTTCTCTGGGGAAAGGGG - Intergenic
1171892019 20:30725297-30725319 GTTGAGTTCTCCGTGGAAACTGG + Intergenic
1173822229 20:46026840-46026862 GATGGGTTCCCCAGGGAAAGAGG + Intronic
1174275757 20:49402810-49402832 GTTTGTTTCTACTGAGAAACTGG - Intronic
1174449561 20:50610902-50610924 GTTTGCTTCTCCCGGAAAAAGGG + Exonic
1175584517 20:60127353-60127375 GTTAAGTTCTCCAGAGAGACAGG - Intergenic
1176139532 20:63538902-63538924 GTTTGGTGCTCCTGGGTATCTGG - Intergenic
1176625164 21:9086685-9086707 GTTGAGTTCTCCGTGGAAACTGG - Intergenic
1176944831 21:14966802-14966824 GTGAAGTTATCCAGGGAAACAGG + Exonic
1178025995 21:28467766-28467788 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1179180791 21:39043235-39043257 TTAGGGATCTCCAGGGAAACAGG - Intergenic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1181430543 22:22879010-22879032 GTTTGGCTGTGCAGGAAAACTGG - Intronic
1181840896 22:25659582-25659604 GTTTGGTTGTCCAGGTAACCTGG - Intronic
1182498942 22:30731680-30731702 TTTTTGTTCTCCAAGGAAAACGG - Intronic
1184053874 22:42031071-42031093 GTTTGGTGGACCAGGTAAACAGG - Intronic
1184059568 22:42073960-42073982 GTTTGGCTCTGCCGGGAAAGTGG + Intergenic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
950408592 3:12819979-12820001 GTTCTGTTTTCCAGGGAAGCAGG + Intronic
950592642 3:13949723-13949745 GCTTTGTGCACCAGGGAAACAGG - Intronic
950799472 3:15538334-15538356 GTGGGCTTCTCCAGGGACACAGG - Intergenic
950822629 3:15777369-15777391 ATTTGGTTCTACACGGAATCAGG + Intronic
951582410 3:24180022-24180044 GAATGGGTTTCCAGGGAAACAGG - Intronic
955043809 3:55341006-55341028 GTCGGGTCCTCCAGAGAAACAGG - Intergenic
955823949 3:62925115-62925137 TTATGGTTATTCAGGGAAACAGG - Intergenic
957587076 3:82146348-82146370 GTCAGATTCTCCAGAGAAACAGG - Intergenic
957687443 3:83520361-83520383 GTGTGTTTCTCGAGGGAAAGGGG - Intergenic
958132828 3:89451134-89451156 GTGTTGTTGTCCAGGGACACTGG - Intronic
958688782 3:97433789-97433811 GTTTGGTACTGCAGGGGATCTGG - Intronic
961985787 3:131132565-131132587 TTTTGTTTCCTCAGGGAAACTGG + Intronic
964359838 3:155883650-155883672 CTTTGGTTCTTCATGCAAACAGG + Intronic
967962112 3:194933755-194933777 TTCTGGTTCTGCAGGAAAACAGG - Intergenic
967964109 3:194947107-194947129 GTTAGGCTCTCCAAGGAAATGGG + Intergenic
968826812 4:2904317-2904339 TTTTGGTTGTCCTGGGAGACAGG - Intronic
970799424 4:19954517-19954539 GTATGCTGCACCAGGGAAACTGG - Intergenic
972652884 4:41036349-41036371 GTTTGTTTGGTCAGGGAAACAGG - Intronic
973195236 4:47432121-47432143 GTTTTGTTTTTCAGAGAAACAGG + Intergenic
973581391 4:52347851-52347873 GCTTTGTGCACCAGGGAAACAGG - Intergenic
973960810 4:56107998-56108020 GAGTAGTTCTCCAGGGCAACAGG - Intergenic
974714455 4:65649319-65649341 CTTTGGATGTCCAGGGAAATAGG - Intronic
980132343 4:128828512-128828534 ATTTGCTTCTCCAGGGAACTTGG - Intronic
980771176 4:137375238-137375260 GTTTGGTTAGCCAGGGAAGAAGG + Intergenic
981008146 4:139896843-139896865 GGATGGTTCTACAGGGAAAGGGG + Intronic
981768581 4:148280279-148280301 TTTTATTTCTCCAGGGAAATAGG - Intronic
986900811 5:12431235-12431257 GTATTGTTCTACAGGGATACAGG - Intergenic
988885494 5:35552947-35552969 GTTTGTTTTTTTAGGGAAACAGG - Intergenic
991631004 5:68656333-68656355 GGATGGGTCTCCAGGGAAAGGGG - Intergenic
992173748 5:74129055-74129077 ATTTGGTTCTCCCAGAAAACAGG + Intergenic
992199377 5:74368716-74368738 ATTAGGATTTCCAGGGAAACTGG + Intergenic
992784085 5:80153835-80153857 TAGTGGTTCTGCAGGGAAACAGG - Intronic
994635579 5:102341419-102341441 GCTTTGTTCACCAGGGAAACAGG - Intergenic
996421401 5:123266920-123266942 GTTTTGTTCACCTGGGCAACTGG + Intergenic
997158691 5:131584753-131584775 GTTTGGTGGGCCAGGGAATCTGG - Intronic
999747348 5:154602629-154602651 TTAGGGTTCTGCAGGGAAACAGG - Intergenic
1001098365 5:168794004-168794026 GTTTGGATTTCCAGGGAGATGGG + Intronic
1001133158 5:169080940-169080962 GTTGGCTTCTCCAGGGTACCTGG - Intronic
1002305347 5:178279676-178279698 GCTGGGTGCTCCAGGGACACAGG + Intronic
1002414402 5:179111936-179111958 GTTTGGTTCTCCAGGAGACACGG + Exonic
1002819338 6:710522-710544 GTTTACTTCTTCAGGGAAAAGGG - Intergenic
1004698659 6:18058007-18058029 GAGTGGATCTCCATGGAAACAGG - Intergenic
1007210692 6:40191590-40191612 CTTGGGTTCTCCATGGAAACTGG - Intergenic
1010734609 6:79429549-79429571 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
1011582902 6:88890552-88890574 TTTTGCTTGTCCATGGAAACAGG + Exonic
1014194956 6:118544702-118544724 GTTTGGGTCTCCAGGTTATCTGG + Intronic
1014334623 6:120117380-120117402 TTTTGTTTCTCCAGGGTAAATGG + Intergenic
1015392074 6:132694007-132694029 ATTTGATTCTCAAGGAAAACTGG - Exonic
1017151660 6:151286240-151286262 GTTTGCTTCTGCAGGAAAAAGGG - Intronic
1018439141 6:163793052-163793074 GTTTTGTTCTACAGGGAAGGAGG - Intergenic
1020365957 7:7380781-7380803 GCCTGGATCTCCAGGAAAACAGG - Exonic
1020404783 7:7819592-7819614 TTTTGGTTCTCCATGTCAACAGG - Intronic
1022358527 7:29638367-29638389 GGTTGATCCTCCAGGGAAAATGG + Intergenic
1022459354 7:30589989-30590011 GTTTTGTTTTTCAGGGAATCTGG - Intergenic
1023665090 7:42514529-42514551 GTTTAGTTCTACAGAGAAAGGGG + Intergenic
1024670274 7:51587877-51587899 GTTGGGGTCTCCAGGGAATGGGG + Intergenic
1026390167 7:69893057-69893079 GGCTGCTTATCCAGGGAAACAGG - Intronic
1028343161 7:89747265-89747287 CTTTGGTCCTCAAGGGAATCTGG + Intergenic
1031293195 7:119965734-119965756 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1032448463 7:132004705-132004727 ATTTGCTTCTACAGGGAGACAGG + Intergenic
1035015228 7:155759839-155759861 CTTTGGATTGCCAGGGAAACCGG + Intronic
1039115708 8:34089266-34089288 GCTTTGTGCACCAGGGAAACAGG + Intergenic
1039854768 8:41402752-41402774 GCTTGGTTCTCTAGGGAGAAAGG - Intergenic
1040632188 8:49228058-49228080 GTTTGTTTCTCCAGAGAATTAGG + Intergenic
1044995603 8:97835419-97835441 GTTTGGTTTAGCTGGGAAACTGG - Intronic
1048709952 8:137198887-137198909 TTAAGGTTCTCCAGAGAAACAGG + Intergenic
1050526608 9:6551965-6551987 GTTTGGTTCTCCTTGGAATGGGG + Intronic
1050629988 9:7549018-7549040 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
1050686546 9:8176545-8176567 GTTTGGTTTTCTAAGGAAGCAGG - Intergenic
1051739395 9:20236903-20236925 GTTTGGTCCTGCAGGAAATCAGG + Intergenic
1052935378 9:34088647-34088669 GGTTGGTTCTCATGGGAATCAGG + Intronic
1054356798 9:64070403-64070425 GTTGAGTTCTCCGTGGAAACTGG - Intergenic
1055071372 9:72169807-72169829 ATTTGGTTTTCCAGGGGAACTGG + Intronic
1057073470 9:92120777-92120799 ATAGGGCTCTCCAGGGAAACAGG + Intergenic
1057921054 9:99097160-99097182 GGATGTGTCTCCAGGGAAACAGG + Intergenic
1059005003 9:110392627-110392649 GTTTGGTTATCTAGTCAAACAGG + Intronic
1060333058 9:122693604-122693626 GTTTGGAACTCTACGGAAACAGG - Intergenic
1061826662 9:133262158-133262180 TTTTGGTTTTCCTGGAAAACAGG + Exonic
1203561386 Un_KI270744v1:60862-60884 GTTGAGTGCTCCATGGAAACTGG + Intergenic
1185659173 X:1713220-1713242 GCTTTGTCCTCCAGGGAAGCTGG + Intergenic
1193924072 X:87464269-87464291 GTATAGTTCACCAGGGAAGCGGG - Intergenic
1195582196 X:106517829-106517851 GTTTCTATCTCCAGAGAAACAGG - Intergenic
1195877828 X:109560825-109560847 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1196493001 X:116290550-116290572 GCTTTGTGCACCAGGGAAACAGG + Intergenic
1196715780 X:118809765-118809787 GTTTGGTTCTCCAGGGCATAAGG - Intergenic
1198641342 X:138759437-138759459 GTTTGCTTGTTCAGAGAAACAGG - Intronic
1199057153 X:143310304-143310326 ATTTGATTTTCAAGGGAAACTGG + Intergenic
1201161684 Y:11172115-11172137 GTTGAGTTCTCCGTGGAAACTGG - Intergenic