ID: 944154014

View in Genome Browser
Species Human (GRCh38)
Location 2:196592747-196592769
Sequence GAGCGCGCGGCCCTCGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944154014_944154023 15 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154023 2:196592785-196592807 CCGTCGCCACAAGCTGCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 60
944154014_944154020 12 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154020 2:196592782-196592804 CGCCCGTCGCCACAAGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 48
944154014_944154024 16 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154024 2:196592786-196592808 CGTCGCCACAAGCTGCGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 37
944154014_944154019 11 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154019 2:196592781-196592803 GCGCCCGTCGCCACAAGCTGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
944154014_944154025 17 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154025 2:196592787-196592809 GTCGCCACAAGCTGCGGGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 101
944154014_944154028 29 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154028 2:196592799-196592821 TGCGGGTGGGGACCCGGCCGCGG 0: 1
1: 0
2: 0
3: 28
4: 252
944154014_944154029 30 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154029 2:196592800-196592822 GCGGGTGGGGACCCGGCCGCGGG 0: 1
1: 0
2: 3
3: 40
4: 275
944154014_944154027 23 Left 944154014 2:196592747-196592769 CCTGCGGCGAGGGCCGCGCGCTC 0: 1
1: 1
2: 2
3: 21
4: 149
Right 944154027 2:196592793-196592815 ACAAGCTGCGGGTGGGGACCCGG 0: 1
1: 0
2: 0
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944154014 Original CRISPR GAGCGCGCGGCCCTCGCCGC AGG (reversed) Intronic
900786898 1:4655143-4655165 GGGCTCGCGGCCCCCTCCGCCGG - Exonic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
904746865 1:32716726-32716748 GAGGGCGTGGCCCTGGCTGCAGG + Intergenic
905890574 1:41516235-41516257 GAGCGCGCGGCGGGCGCCGCTGG + Intronic
905912174 1:41662474-41662496 GAGCACGGGGACCCCGCCGCCGG + Intronic
907513785 1:54980758-54980780 GAGCGCGCAGCCCTCGGGGCGGG + Intergenic
908354574 1:63317583-63317605 GGGCGCGCGCCCCTCTCCGCCGG - Intergenic
908572176 1:65421004-65421026 GAGGGCGCCGCTCTCGCCGAGGG - Intronic
911073114 1:93847515-93847537 GAGCGCGGGGCCGTCGCCTCTGG + Intergenic
913658391 1:120983392-120983414 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914009759 1:143766501-143766523 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914648377 1:149675162-149675184 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
915530637 1:156500521-156500543 GAGCGGGTAGCCCTCGCCCCTGG + Exonic
917846725 1:179026122-179026144 GGGCGCGCGACCCCCGCCCCCGG + Intronic
917974684 1:180231029-180231051 GAGAGCGCGTCTCTCGCCCCTGG + Intronic
921024049 1:211260554-211260576 CAGAGCGCGGCCCTCGGCGCCGG - Intronic
922802666 1:228371425-228371447 GAGCACGGGGCCCTGGCCCCGGG + Exonic
1065390154 10:25174917-25174939 GGGCGCGCGCCCCGCGCCTCCGG + Intergenic
1067091301 10:43266902-43266924 CAGCGCGCGGCCGGCGCCGGCGG + Intronic
1069457201 10:68562116-68562138 GCGCGCGCGGCTCACCCCGCCGG - Intronic
1069976287 10:72216008-72216030 GCGCACGCCGCCTTCGCCGCTGG + Exonic
1073262504 10:102201137-102201159 GAGCGGCCGGCCAGCGCCGCCGG - Intergenic
1073292385 10:102419639-102419661 GGGCGCGCGGGGCTCACCGCGGG + Intronic
1075940675 10:126388132-126388154 GGGCGCGCTGCCATCGTCGCCGG + Exonic
1076279274 10:129232009-129232031 GAGAGCGCCGCCCTCGTGGCTGG + Intergenic
1076842375 10:133052164-133052186 GAGCGGGCGGGCCCAGCCGCTGG + Intergenic
1076895416 10:133309022-133309044 AAGGGCGCGGCCCCAGCCGCGGG - Exonic
1077281748 11:1749141-1749163 GAGCGCGCGGGGCTCGGCGGCGG + Intronic
1080588405 11:33700771-33700793 GAGCGCGCGTCTCCCGGCGCGGG - Exonic
1081812903 11:45923172-45923194 GTGCGCGCGGCCCTGGCGGCGGG + Intronic
1083176116 11:60951462-60951484 GTGCGCGGGGCCCTCGACGGTGG - Exonic
1083936899 11:65873853-65873875 GAGCCCCAGGCGCTCGCCGCGGG - Intergenic
1084891746 11:72240137-72240159 GAGCGCGCGGCCAGCGCCAAGGG - Exonic
1085040032 11:73321600-73321622 GAGCGCTCAGCCCTGGGCGCTGG + Intronic
1085289855 11:75390153-75390175 GCGCCAGCGTCCCTCGCCGCCGG + Intergenic
1085295564 11:75429817-75429839 CAGCGGGCGGCACTCGCCGCAGG + Exonic
1088716502 11:112554159-112554181 GAGCGCTGGGCCCTCTCCCCCGG + Intergenic
1090189596 11:124759548-124759570 GAGCAGGCGGCCAACGCCGCGGG + Intronic
1091273149 11:134331985-134332007 GCGCGCGGGAGCCTCGCCGCGGG - Exonic
1091586584 12:1820380-1820402 GTGAGCGCTGCCCTCGCGGCCGG + Exonic
1094107776 12:26832543-26832565 GAGCGCACGGCGCTGTCCGCGGG + Intronic
1094375443 12:29783877-29783899 GAGCGCGGGGAGCTCGCGGCGGG - Intronic
1096413162 12:51391564-51391586 GAGCCCGCGACCCTCTCCCCGGG - Intronic
1097676057 12:62603385-62603407 GAGGGAGCGGCTCTCTCCGCAGG + Exonic
1102492930 12:113299650-113299672 GAGAGTGCGGCCCTTGCTGCTGG - Exonic
1104025756 12:125025030-125025052 GAGCGCGCGGGCCGGGCTGCTGG - Exonic
1106517039 13:30464992-30465014 GGGCGCGCGGCCCGCGCGGAGGG - Intronic
1107133449 13:36920091-36920113 GAGTGCGCGGCGCTCGGAGCGGG - Intronic
1108221090 13:48233567-48233589 GGGCGCGGGGCTCGCGCCGCGGG + Intronic
1109062431 13:57634468-57634490 CAGCGTGCGGATCTCGCCGCTGG - Exonic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113799356 13:113078387-113078409 GAGCGCACCGCCCTCGGAGCTGG - Exonic
1113981755 13:114281991-114282013 GAGCGCGCGGCCGTTCCCACCGG - Intronic
1119500872 14:75126683-75126705 GAGGTAGCGGCCCTCGGCGCCGG - Exonic
1122721537 14:103725140-103725162 GAGGACGCCGCCATCGCCGCCGG - Intronic
1122904586 14:104795843-104795865 GCGCGCTCCGCCCTCGCCGCCGG - Intergenic
1123024913 14:105419982-105420004 GCGGGCGCGGCGCTCGGCGCGGG - Exonic
1124790111 15:32718787-32718809 CGGGGCGCGGCCCTGGCCGCGGG + Intronic
1132807693 16:1782599-1782621 GTGTGCCCGCCCCTCGCCGCCGG - Exonic
1132864221 16:2085672-2085694 GTGCGCCCGGCCCCCGCTGCTGG - Intronic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1136129659 16:28211785-28211807 GACCGCGCGGCCCAGGCGGCCGG + Exonic
1136641523 16:31569340-31569362 GCGCCCGCCGCCCTCGTCGCAGG - Intergenic
1138471961 16:57245143-57245165 GCGCGCGCCGCCGACGCCGCAGG - Exonic
1138588055 16:57984591-57984613 GCCCGCGCGGCCGTAGCCGCAGG - Intronic
1142295382 16:89218094-89218116 GAGCGCGCGTCCCTCGCCGCCGG + Intronic
1142631460 17:1229046-1229068 GGGCGCGCAGCCCCCGCCGCTGG - Intergenic
1143508173 17:7381007-7381029 GAGGGCGGGGACCTGGCCGCTGG - Exonic
1144613505 17:16746768-16746790 GAGCGCGCGGCCGTTCCCACCGG + Intronic
1148697506 17:49570108-49570130 GAGCGCGCGGCGGGCGCGGCGGG + Intergenic
1151954509 17:77373690-77373712 GGGCGCGCGGCGCTCTCAGCGGG - Intronic
1152542045 17:80981438-80981460 AAGCCGGCGGCCCTCGCAGCTGG - Intergenic
1152718380 17:81910846-81910868 GAGCCCGCGGGCTTCACCGCGGG + Intronic
1152744109 17:82031393-82031415 GCGCGCGGAGCCCTCCCCGCCGG + Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1154266435 18:12883402-12883424 GAGAGCGCTGCCCTCGCCAGAGG + Intronic
1156243058 18:35271915-35271937 GAGCGGCCGGCCAGCGCCGCCGG - Intronic
1160025470 18:75211922-75211944 GGGCGCGCGGCCCGCGCCGCGGG + Intronic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160991858 19:1863379-1863401 GAGGGCGCGGGCCCCGCCGCCGG - Exonic
1161027256 19:2042397-2042419 GAGCCCCCAGCCCTCCCCGCGGG + Intronic
1161265116 19:3360215-3360237 GAGCGCGCCGCGGCCGCCGCCGG + Intronic
1161505037 19:4639387-4639409 GAGCGCTCGGCCCGCCCCCCAGG + Intergenic
1161703258 19:5805970-5805992 GAGGGCCCGGCCCTCACCGGAGG - Intergenic
1161793193 19:6373040-6373062 GAGCCCCCGTCCCTCGCCCCCGG - Intronic
1161839032 19:6667481-6667503 GAGGGCGTGGCCCCCGCTGCAGG - Intronic
1161925065 19:7293923-7293945 GAGCGCGCGGCGCTGGCCCGCGG + Exonic
1163667858 19:18611611-18611633 GGGCTGGAGGCCCTCGCCGCCGG + Intronic
1165065454 19:33225781-33225803 GAGCTCACGGCCCTCGCAGCCGG + Exonic
1165940749 19:39413632-39413654 CAGCGCGCAGCCCTCGGCGGGGG + Intronic
1166185150 19:41134870-41134892 GAGCGCGCGGTCCAGGCCTCCGG - Intergenic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1168103978 19:54155578-54155600 GAGGGGGCAGCCCTCGCCCCCGG - Exonic
1168154518 19:54465339-54465361 GAGCGCGGGGCCCCCGCGGGGGG + Exonic
927652306 2:24920077-24920099 GCGCGCGGGGCCCTCCCCGGCGG + Intergenic
932567361 2:72918163-72918185 GAGCGAGCGGCCCGCGCCCGCGG - Exonic
932599193 2:73112473-73112495 GAGCTCGCGGCCCAGGGCGCCGG + Exonic
934031857 2:88055590-88055612 GACCGGGCCGCCCCCGCCGCCGG + Intronic
935731063 2:106065458-106065480 GGCCACGCGGCCCCCGCCGCCGG + Intronic
937261224 2:120587683-120587705 GAGGGCGCGGCCCGGCCCGCGGG - Intergenic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
938058266 2:128233135-128233157 GGGCGCTCGGGCCGCGCCGCCGG - Intergenic
938058337 2:128233396-128233418 GGTCGCGCGGCCGTCGCCGCCGG - Intergenic
944154014 2:196592747-196592769 GAGCGCGCGGCCCTCGCCGCAGG - Intronic
945251040 2:207767049-207767071 GTGAGCGCGGCGCTCGCCTCGGG + Exonic
946692368 2:222319365-222319387 AAGCGCGCGGCGCTCACCGCTGG - Intergenic
946706061 2:222460051-222460073 AAGCGCGCGGCCCTCGGTGACGG + Intronic
1169367187 20:5001258-5001280 GGGCGCGCAGGCCGCGCCGCGGG + Intronic
1170756914 20:19212853-19212875 ACGCGCGCGGTCCTCGTCGCCGG - Exonic
1172360912 20:34312014-34312036 GAGCGCCCCTCCCTAGCCGCGGG + Intergenic
1174475759 20:50794877-50794899 CAGCGCGCGCCGCTCGCCACTGG + Exonic
1179511823 21:41878816-41878838 GGCCCCGCGGCCCCCGCCGCCGG - Exonic
1182903943 22:33920713-33920735 AGGCGGGCGGCCCCCGCCGCCGG + Intronic
1182903968 22:33920791-33920813 GAGCGCCCGGCGCTCGGAGCTGG + Intronic
1183788408 22:40045217-40045239 GAGCGCGCGCTCAGCGCCGCCGG - Intronic
1184593825 22:45502737-45502759 GGGCGCGCGCCCCTCGCAGCCGG + Intronic
1185345015 22:50307302-50307324 GGACGCGCAGCCCCCGCCGCCGG + Intronic
1185418051 22:50720726-50720748 GAGCGCGCGGCCCTGGCCGTGGG + Intergenic
949987861 3:9553826-9553848 GAGAGCGCGCGCCTCGGCGCGGG - Intergenic
950438466 3:12994107-12994129 GAGCGCGCCGTCCCCGCGGCCGG + Intronic
952867296 3:37862314-37862336 GAGCGCACACCCCGCGCCGCTGG + Intronic
954277988 3:49554741-49554763 GACCGCGCTGCTCCCGCCGCGGG - Exonic
961665124 3:128489625-128489647 GAGCGCGAGGCCCTTGGCGCCGG + Intronic
966905984 3:184526027-184526049 GAGCGCGCAGCCCAGGCCTCTGG + Intronic
968384571 4:124793-124815 GAGCGCGGGTCCCTCACCGGAGG - Exonic
968393569 4:212918-212940 GAGCGCGGGTCCCTCACCGGAGG - Intergenic
968419730 4:473829-473851 GAGCGCGGGTCCCTCACCGGAGG + Intronic
968562223 4:1290068-1290090 GCTCCCGCCGCCCTCGCCGCTGG - Intronic
968573984 4:1356456-1356478 GAGCCCACTGGCCTCGCCGCTGG + Intronic
969379354 4:6783522-6783544 GAGCGAGCGGCCCAGGCTGCCGG - Intronic
975870648 4:78775978-78776000 AGGCGCGCTGCCCGCGCCGCCGG - Intergenic
985111925 4:186555287-186555309 CGGCGCGCGGCCCTCGTGGCTGG - Exonic
985512712 5:321483-321505 CAGCGCGCGACCCCCGCCTCGGG + Intronic
987379930 5:17275607-17275629 GAGAGCGCGGCCCCTGCCGCCGG + Exonic
997253664 5:132410797-132410819 GAGCCCGGGGCCCCCGCCTCTGG + Intronic
997470609 5:134115084-134115106 GAGGGCGCGGCCGGCGGCGCAGG + Exonic
1002928642 6:1619286-1619308 GGGCGCGCCCCCCTCGCCCCTGG - Intergenic
1003049465 6:2766227-2766249 GTGCGGGCGGCCCCCGCCACTGG - Exonic
1003645573 6:7910763-7910785 GGGCGCGCGGGCATCGCGGCGGG + Exonic
1007082067 6:39114810-39114832 GAGGGCGCGGCCCTAGCTGCCGG - Intronic
1007775761 6:44223600-44223622 GAGCGCGCGGATCTCAGCGCGGG + Intronic
1010141879 6:72622131-72622153 GAGGCCGCTGCCCCCGCCGCAGG + Exonic
1011193707 6:84762629-84762651 GACCCCTCTGCCCTCGCCGCAGG - Exonic
1011277438 6:85643758-85643780 GCGCGCCCGGCCCCCGCCCCCGG + Intronic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1019618941 7:1980176-1980198 GAGCGTGCGCACCTCCCCGCTGG + Intronic
1022923288 7:35037252-35037274 GAGCGCGCGCCCCTGTCCCCGGG - Intronic
1033199774 7:139359167-139359189 GAGCCAGCGGCGCTGGCCGCAGG - Intronic
1034418705 7:150978124-150978146 GAGCGCGAGCCGCCCGCCGCCGG + Exonic
1034977915 7:155458676-155458698 GCTCGCGCCGCCTTCGCCGCCGG - Exonic
1036801357 8:11794896-11794918 GAGCGGGCGGCCGGCCCCGCCGG + Intergenic
1037450682 8:19013658-19013680 GAGCACGCGGCGCTGGCCGCCGG - Exonic
1044698858 8:94949047-94949069 GGGCGCGCGGCCGGCCCCGCCGG + Intronic
1044857742 8:96493829-96493851 GAGCGCGCGATCCGCGCGGCTGG - Exonic
1045516257 8:102863500-102863522 GCGCGCGGGGGTCTCGCCGCCGG - Intronic
1049482699 8:142834545-142834567 AAGCGCACGGCCCTGGCTGCTGG - Intronic
1049788519 8:144462599-144462621 GAGCCCGCGGGCCCCGCGGCCGG + Intronic
1050305312 9:4299926-4299948 GTGGCCGCGGCACTCGCCGCCGG + Intronic
1052014832 9:23452126-23452148 GAGCGCCCGGCCAGTGCCGCTGG + Intergenic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1060897161 9:127225287-127225309 GAGCCCGCGGCCCCCGCCCGGGG + Intronic
1060982723 9:127803020-127803042 GAGCGCGTGGCCGGTGCCGCAGG + Exonic
1061108751 9:128552403-128552425 GATCGCTCGGCCCTTTCCGCCGG + Intergenic
1061836230 9:133331929-133331951 GAGCAGGCGGCGCTCGGCGCGGG + Exonic
1062280827 9:135750920-135750942 GAGGCCGCTGCCCTCCCCGCAGG + Exonic
1062362393 9:136193976-136193998 CAGCGCCCGTCCCTGGCCGCGGG + Intergenic
1062383809 9:136300248-136300270 GAGCTCGCGCCCCTGGCCGTGGG + Exonic
1185461441 X:334459-334481 GAGTGCGCTGCGCTCCCCGCTGG - Exonic
1193655005 X:84188030-84188052 GCGAGCGCTGCCCTCGCCGCCGG + Intergenic
1196389451 X:115192209-115192231 GAGGCCGCGGCCCCCGCCGTAGG - Exonic
1199699625 X:150365545-150365567 CAGCGGGCGCCCCTCGCCGCCGG + Intronic
1200003143 X:153072327-153072349 GAGCGCAGGGCCGTTGCCGCGGG - Intergenic
1200004580 X:153077682-153077704 GAGCGCAGGGCCGTTGCCGCGGG + Intergenic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic