ID: 944154113

View in Genome Browser
Species Human (GRCh38)
Location 2:196593144-196593166
Sequence CGGAGCCGCCTCGAGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944154113_944154116 -3 Left 944154113 2:196593144-196593166 CCAGAGCTCTCGAGGCGGCTCCG No data
Right 944154116 2:196593164-196593186 CCGCGCCGCCACCCACCCCCGGG No data
944154113_944154120 8 Left 944154113 2:196593144-196593166 CCAGAGCTCTCGAGGCGGCTCCG No data
Right 944154120 2:196593175-196593197 CCCACCCCCGGGTTACGCCACGG No data
944154113_944154114 -4 Left 944154113 2:196593144-196593166 CCAGAGCTCTCGAGGCGGCTCCG No data
Right 944154114 2:196593163-196593185 TCCGCGCCGCCACCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944154113 Original CRISPR CGGAGCCGCCTCGAGAGCTC TGG (reversed) Intronic
No off target data available for this crispr