ID: 944158891

View in Genome Browser
Species Human (GRCh38)
Location 2:196638783-196638805
Sequence GAATATGTATTCTCACTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944158891_944158893 5 Left 944158891 2:196638783-196638805 CCCTTAAGTGAGAATACATATTC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 944158893 2:196638811-196638833 GCAAAACAACTCAGAAACGCTGG 0: 1
1: 0
2: 3
3: 15
4: 138
944158891_944158894 10 Left 944158891 2:196638783-196638805 CCCTTAAGTGAGAATACATATTC 0: 1
1: 0
2: 1
3: 25
4: 224
Right 944158894 2:196638816-196638838 ACAACTCAGAAACGCTGGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944158891 Original CRISPR GAATATGTATTCTCACTTAA GGG (reversed) Intergenic
900860939 1:5230386-5230408 GAATATGTATTTCCACTTCTGGG - Intergenic
905984991 1:42272028-42272050 TAATATGTAATCTCCCTTCAAGG + Intronic
907423260 1:54361821-54361843 CAATGTGGATTCTCATTTAATGG + Intronic
907623212 1:56003114-56003136 GAATAGCTATTCTCACTTTAGGG - Intergenic
908550794 1:65206867-65206889 GAATATGCATTTTCCCTTATGGG + Intronic
908650254 1:66325137-66325159 GAGTAAGTATGCTAACTTAAAGG + Intronic
909158731 1:72116663-72116685 TAATATTTATTCTGACTTACAGG + Intronic
909963403 1:81877121-81877143 TAATAGATATTCTCACTTCAAGG + Intronic
910206926 1:84757610-84757632 GAACAACTATTCTCACTAAAAGG - Intergenic
910639672 1:89446352-89446374 GACTATCTATGTTCACTTAAGGG + Intergenic
911035139 1:93534992-93535014 AAATATTTATTCTCCATTAATGG - Intronic
912668008 1:111600390-111600412 GAATATCCATTTACACTTAAGGG - Intronic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
916915043 1:169397267-169397289 GAATGTTTATTCTTCCTTAAAGG - Exonic
919256645 1:195133745-195133767 GAATGTGTGTTCTCAGTTACTGG - Intergenic
920153378 1:203927944-203927966 TATTACGTATTCTCACTTATAGG + Intergenic
921915240 1:220601718-220601740 TAATATGTGTACTGACTTAATGG + Intronic
922883008 1:228996782-228996804 GAACATGAAGTCCCACTTAAAGG + Intergenic
923288069 1:232516238-232516260 GAAGATCTCTTCCCACTTAAAGG - Intronic
923637485 1:235714452-235714474 GAATTTGTATTCACTCTTATTGG - Intronic
1063302217 10:4860302-4860324 GAATATGTCTTCTCTCTTCACGG + Intergenic
1066490748 10:35892132-35892154 GAATATTTATTTGCATTTAAAGG + Intergenic
1067968584 10:50942911-50942933 GAAGAATTATACTCACTTAAGGG - Intergenic
1068308301 10:55244417-55244439 GAATATCTTTTCTAAATTAAAGG + Intronic
1068402755 10:56551721-56551743 GAATATGTATACAAACTTGAAGG + Intergenic
1069613894 10:69793933-69793955 GAAGATGAATTCTTACTTAGGGG - Intergenic
1070329691 10:75408467-75408489 GAAAATGTGTTCCCATTTAAAGG - Intergenic
1072477830 10:95780291-95780313 ACATATTTATTCTTACTTAAAGG - Intronic
1074768337 10:116716792-116716814 GAATACCAATTCTCACTTCATGG - Intronic
1079605754 11:22363974-22363996 AAATTTGTATTCTTACTTTAAGG - Intronic
1085140165 11:74132895-74132917 CAAAATGTATTCTCAGTTGAAGG + Exonic
1086078770 11:82881291-82881313 GTGTATTAATTCTCACTTAATGG + Intronic
1088080493 11:105906284-105906306 AAATATGTTTTCTCACTTACAGG - Intronic
1088513605 11:110602673-110602695 AATTATCTATTCTCACTAAAAGG - Intronic
1094386636 12:29901614-29901636 GATTATGTTTTGTAACTTAAAGG - Intergenic
1096861913 12:54535281-54535303 GAATATATAATCTCAAATAAAGG - Intronic
1097547023 12:61016411-61016433 GAATTTTTATTTTCACTTGAAGG + Intergenic
1098908153 12:76182252-76182274 GCATAAGTTTTCTCATTTAAAGG + Intergenic
1099185972 12:79515753-79515775 TAATCTGTCTTTTCACTTAATGG + Intergenic
1099537880 12:83867001-83867023 GACAATGTTTTCTCAATTAATGG + Intergenic
1099727604 12:86453111-86453133 GCATATTCATTCTCATTTAAAGG - Intronic
1100683761 12:96961740-96961762 GCATATGTTTTTTCACTTTATGG - Intergenic
1106369200 13:29114829-29114851 AAATTTGTATTTTCAATTAAGGG + Intronic
1106665925 13:31850843-31850865 GAATATGTATTCTAACCAACAGG - Intergenic
1106870848 13:34018609-34018631 GAAGATGTATTCTCCCTATATGG + Intergenic
1110423108 13:75335423-75335445 GAATATATATACTTACTAAATGG + Intronic
1111970870 13:94914948-94914970 GAATATTTATACTAACTTAGTGG + Intergenic
1112729956 13:102349794-102349816 GAATATGTACTTTCACTATATGG + Intronic
1114777869 14:25505523-25505545 GAATATTTATTGTCACTTCCAGG - Intergenic
1116353781 14:43901208-43901230 AAATATAAATACTCACTTAACGG - Intergenic
1117949457 14:61067266-61067288 AAATATGTAATCTCACTTGAAGG - Intronic
1120393223 14:83934856-83934878 GGATATGAATTCTCACTTGGAGG - Intergenic
1121399461 14:93659907-93659929 GAATATGTTTTTTCATTAAATGG - Intronic
1124390884 15:29256098-29256120 TACTATATATTCTCACTTATAGG + Intronic
1124505988 15:30274235-30274257 GAAAGTTTATTCTGACTTAAGGG - Intergenic
1124737565 15:32264397-32264419 GAAAGTTTATTCTGACTTAAGGG + Intergenic
1125305030 15:38302139-38302161 GAATATTTATTCTTTCTTCAAGG - Intronic
1127413940 15:58738265-58738287 GAATATGTATTATCAAATAAAGG - Intronic
1127474931 15:59324276-59324298 GAAAACATATTCTCTCTTAACGG - Intronic
1128514064 15:68331336-68331358 TAACATGTATTTACACTTAATGG - Intronic
1130871807 15:87977862-87977884 GAGTTTGGATTCCCACTTAAGGG - Intronic
1131334357 15:91533347-91533369 GAATATTTCTTCTAACTTGATGG + Intergenic
1131511958 15:93054293-93054315 GAAGAAGTATACTCACTTAAAGG + Intronic
1134146684 16:11770479-11770501 GACAATGTATTCTCCCGTAAAGG - Intronic
1134458710 16:14413630-14413652 GAACATTTATTTTCACTGAAAGG + Intergenic
1136385645 16:29924303-29924325 GAATATGTATAAAAACTTAAGGG - Intronic
1137991201 16:53157650-53157672 AAATATGTATGTTCACTTAATGG - Intronic
1138854754 16:60676560-60676582 AAATATCTATTATCTCTTAATGG + Intergenic
1145410101 17:22652443-22652465 GAATATATTTTCTTACTTATTGG - Intergenic
1146381087 17:32328038-32328060 CAGTGTGTCTTCTCACTTAATGG - Intronic
1149533639 17:57415524-57415546 GAAATTGTATGCCCACTTAACGG - Intronic
1150866405 17:68855273-68855295 GAGTATGTTTTCTCATTTAAAGG - Intergenic
1155709874 18:28863098-28863120 ACATATGTATAATCACTTAAAGG + Intergenic
1155744569 18:29337743-29337765 GATTATGACTTCTCCCTTAAGGG + Intergenic
1156978731 18:43259588-43259610 AAATCTATACTCTCACTTAAGGG - Intergenic
1157331882 18:46710213-46710235 GCATTTGTCTTCTCACTTAGTGG - Intronic
1157779576 18:50425659-50425681 GAATTTGTTTTCACTCTTAATGG - Intergenic
1158285770 18:55880883-55880905 TCATATTTATTCTCACTTTAAGG + Intergenic
1159162898 18:64667368-64667390 TAATGTGCATTCTCACATAATGG + Intergenic
1159234432 18:65652351-65652373 GGAGATGTATTTTCACTTATTGG + Intergenic
1159411534 18:68082275-68082297 AAATATGTAGACTCACTTAATGG + Intergenic
1159424978 18:68273143-68273165 GAAAATGTATTCTTACTTGATGG + Intergenic
1162669686 19:12245276-12245298 TAATATATATTCTCAGGTAATGG + Intronic
1166120247 19:40682093-40682115 GCATATGCTTTCTCACTTAATGG + Intronic
1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG + Intergenic
925658609 2:6178759-6178781 GGATTTGTTTTCTCACTGAATGG + Intergenic
925721490 2:6832842-6832864 GAAAATTTATTTTAACTTAAAGG + Intergenic
926647595 2:15306151-15306173 TAATATGTATTATAAATTAAGGG - Intronic
929043382 2:37768433-37768455 TAATATGCAATCTTACTTAATGG - Intergenic
929369976 2:41211200-41211222 GAATTTATTTTCTCACTTATGGG + Intergenic
929653815 2:43708958-43708980 AAATATGTATTAACATTTAAGGG - Intronic
930433234 2:51308276-51308298 GAATGTGAATTCTCTCTTATAGG - Intergenic
930597913 2:53410770-53410792 GAAATTGTATTTTCTCTTAAAGG + Intergenic
937101554 2:119274769-119274791 GAATGTGTATTCTCCCTCAAAGG - Intergenic
938403103 2:131010462-131010484 AAATATTTATTTTCTCTTAAGGG - Intronic
940262950 2:151802893-151802915 TGATTTGTATTCTGACTTAATGG + Exonic
940361493 2:152800690-152800712 TAATAAGTATTTTCAATTAAAGG + Intergenic
940554081 2:155200188-155200210 GACTATGTATTCTCAATGAATGG - Intergenic
941132199 2:161666048-161666070 GAATATATATGTTCACTTATAGG - Intronic
941481329 2:166018264-166018286 GAATAAGTGGTTTCACTTAAAGG - Intronic
942080929 2:172398996-172399018 GTTTATGTTTTCTCATTTAAAGG - Intergenic
942708277 2:178801803-178801825 GAATATGTCTTATTCCTTAAAGG + Intronic
944158891 2:196638783-196638805 GAATATGTATTCTCACTTAAGGG - Intergenic
947583472 2:231336650-231336672 GAATTTGGGTTCTCACTTGATGG - Intronic
1169599494 20:7241217-7241239 GGATATGAATTTTCTCTTAATGG - Intergenic
1169940129 20:10927973-10927995 GAAATCATATTCTCACTTAAAGG - Intergenic
1172831356 20:37837882-37837904 GAATTTGTATTCTAATTGAAGGG + Intronic
1174220470 20:48950413-48950435 GAATATGTATTTTCTTTCAATGG - Intronic
1177058983 21:16347497-16347519 CAATATGAATGCTCACTCAAAGG - Intergenic
1177701242 21:24641867-24641889 GATTAAGCATTCTAACTTAAAGG - Intergenic
1181997534 22:26894451-26894473 GATTTTGTTTTCTCAGTTAATGG - Intergenic
1182855866 22:33517130-33517152 TAATACGTATTCACAGTTAAGGG - Intronic
1203295536 22_KI270736v1_random:39875-39897 TAATATGCAATCTCACCTAATGG - Intergenic
949908405 3:8878900-8878922 GAAACTGTATTTTCACTAAAAGG + Exonic
950675812 3:14553822-14553844 GAATGTGCAGGCTCACTTAATGG + Intergenic
951142229 3:19176585-19176607 GAGTATATATTCTCAGTTAAAGG - Intronic
951253425 3:20420587-20420609 GAATATGTAGTCTCATTAAAAGG - Intergenic
951931833 3:27976188-27976210 GAATATGTTTTCTCAGTCATGGG - Intergenic
955020881 3:55119954-55119976 TAAAATGTTTTTTCACTTAATGG + Intergenic
955122010 3:56069829-56069851 GAAGTTGTATTCTAAATTAATGG - Intronic
956451456 3:69379043-69379065 GAAAATGTATTTTCATGTAAGGG - Intronic
957404362 3:79757759-79757781 GAATATATCTTCTCACATGAAGG + Intronic
957917232 3:86701420-86701442 GAATATCGATATTCACTTAAAGG - Intergenic
958485923 3:94708394-94708416 AAATTTGTATTCTAACTTGAAGG + Intergenic
960496281 3:118379085-118379107 ATATATGTATTCTCATTTCATGG + Intergenic
965006055 3:163025337-163025359 GAATATATATTATCACATATAGG - Intergenic
966240359 3:177748913-177748935 GATTATGTATTCTCTCTTGGAGG - Intergenic
966899257 3:184468505-184468527 GAATAGGTATTCCCAGTTTAGGG + Intronic
966995510 3:185276212-185276234 AAATATGTATTCTCACAAAAGGG - Intronic
971377475 4:26066562-26066584 GAAATTGTATCCTCACTTCAAGG + Intergenic
972228869 4:37046993-37047015 GAATATGTATTCCCATTTTCTGG - Intergenic
972852709 4:43070732-43070754 GAATACCTGTTCTCACTTTAGGG - Intergenic
973686375 4:53374383-53374405 GAATATGCTTTCTTAGTTAAAGG - Intergenic
974286580 4:59876783-59876805 AAATATGTTTTCTTATTTAATGG - Intergenic
974372074 4:61030289-61030311 AAATATGTATTCTCCCTTCGAGG - Intergenic
974785605 4:66616498-66616520 GAATATATATTCTGTGTTAATGG + Intergenic
975810606 4:78165000-78165022 TAATTTGTAATCTGACTTAAAGG - Intronic
977118554 4:93066733-93066755 GAATTTGCCTTTTCACTTAAAGG + Intronic
977889762 4:102296045-102296067 GAACATTTACTCTCTCTTAATGG - Intronic
978095832 4:104776126-104776148 AAATATATATTCTCACTCATGGG - Intergenic
979002062 4:115234548-115234570 GAATATGGTTCCTCACTTAGCGG + Intergenic
979863242 4:125721136-125721158 GTATCTGTTTTCTTACTTAAAGG - Intergenic
980182475 4:129418129-129418151 CCAAATGTATTCTCACTTCAGGG - Intergenic
980608261 4:135122122-135122144 CAATATGTATCCTCACTTCTCGG - Intergenic
981755426 4:148137039-148137061 GAGAATTTATTCTCACTTTAGGG + Intronic
982612950 4:157600069-157600091 AAATATGTATTCAAACTTATTGG - Intergenic
983291088 4:165806617-165806639 GTATATGTATTCTCTTGTAAGGG - Intergenic
983393030 4:167158377-167158399 GTATATGTATTCACATTTGATGG - Intronic
984101030 4:175485841-175485863 GAATATGTTGATTCACTTAATGG - Intergenic
985165691 4:187091631-187091653 GAATTTTTATGCTCCCTTAACGG + Intergenic
985251069 4:188024979-188025001 GTATAAGTATTCATACTTAATGG - Intergenic
987641758 5:20621364-20621386 GTAAATGTATTCTAACTAAAGGG + Intergenic
988059131 5:26144061-26144083 GAATCTGTCTGCTCACTTAAAGG - Intergenic
988833791 5:35012011-35012033 TAATAAGTGTTCTCACTTATAGG + Intronic
993235611 5:85305402-85305424 GAATATATAATGTCACTTCATGG + Intergenic
993405060 5:87500942-87500964 GCATATGTTGTCACACTTAATGG + Intergenic
993876469 5:93313111-93313133 GAATATGTTTTCCCAGTTAGTGG - Intergenic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
995243717 5:109913958-109913980 GAAAATGGAATCTCACTGAATGG + Intergenic
997787351 5:136725766-136725788 GAGTATGGATTCTCATTTATGGG - Intergenic
997994367 5:138574027-138574049 TAATATGTATTCCCTCTCAAAGG + Intronic
1000863214 5:166481646-166481668 GGATATATATTTTCACTTTAAGG - Intergenic
1001208322 5:169785846-169785868 GAAAATTTATTCTCATTTAGAGG + Intronic
1003282902 6:4709699-4709721 GAATATGAAAGCTGACTTAAGGG - Intronic
1003943128 6:11047619-11047641 TAACATGAATTCCCACTTAATGG + Intergenic
1004459053 6:15818462-15818484 GTATATATTTTTTCACTTAATGG - Intergenic
1004640362 6:17509198-17509220 GAATATGTAATATTAATTAATGG - Intronic
1006563790 6:34936585-34936607 GAATATGTTTCCTTCCTTAATGG + Intronic
1007471504 6:42093658-42093680 GAAGATGTATTCTGATTTGAGGG - Intergenic
1008756590 6:54802995-54803017 GAATATGTATTGTGATTTTAGGG + Intergenic
1009483113 6:64185413-64185435 GAATATGACTTGTCACTTAGAGG - Intronic
1010364899 6:75039597-75039619 AAATATATATTCTAACTTACAGG + Intergenic
1012262720 6:97106766-97106788 AAATATGTATTCTCATAAAAAGG + Intronic
1013903426 6:115185220-115185242 GGATATTTTTTCTCACTTGAAGG + Intergenic
1014167926 6:118246705-118246727 GGATTTTTATTCTCACTTATAGG - Intronic
1014609350 6:123521995-123522017 GAATGTGTATTATCACCTAGTGG + Intronic
1014633049 6:123811066-123811088 GAATATGTGTCTTCACCTAATGG + Intronic
1016090511 6:139972444-139972466 AAAAATGTACTCTCATTTAAAGG - Intergenic
1016144895 6:140657644-140657666 GAAGATTTATTCTCACATACAGG + Intergenic
1016289412 6:142511599-142511621 GATTATGTGTACTCACTTCAGGG + Intergenic
1016565668 6:145450476-145450498 GTATATGTATTCTCACCAAAAGG + Intergenic
1016742997 6:147547955-147547977 GAATATGAATTTTCTTTTAAAGG + Intronic
1017003136 6:150009769-150009791 CAATATGTATTCACATTTATTGG + Intergenic
1017795333 6:157839401-157839423 GCATATGTATTTTCATGTAATGG + Intronic
1018286328 6:162242508-162242530 GTGTATGTATTCCCACTAAATGG - Intronic
1020769876 7:12377045-12377067 GAAATTGTAATCTCTCTTAAAGG + Intronic
1024259650 7:47564290-47564312 GAATCTGTCTTTTCTCTTAAGGG - Intronic
1024522442 7:50317721-50317743 GAATATGTATTTTCAATTTCAGG - Intronic
1027711512 7:81608261-81608283 GAATATGTAATATGACTAAAAGG + Intergenic
1028326558 7:89533962-89533984 GAATGGGAATTCTCACTTATTGG + Intergenic
1028748400 7:94354284-94354306 GAATTTTTATTCCCAGTTAATGG + Intergenic
1028837912 7:95395634-95395656 GAATGTGTATTATCACTTAAAGG + Intronic
1028937102 7:96477546-96477568 TAATATTTATTCTTACATAATGG - Intergenic
1029991918 7:104970186-104970208 GAATATGTATTTTAATTTAGCGG + Intergenic
1030956066 7:115854354-115854376 TAATTTATATTTTCACTTAAAGG - Intergenic
1031055318 7:116986949-116986971 ACACATGAATTCTCACTTAAAGG - Intronic
1031572050 7:123371228-123371250 AATTATGTATTATCATTTAAGGG + Intergenic
1032104642 7:129016618-129016640 GAATATGTGTTCTTACTAATTGG - Intronic
1033243192 7:139697839-139697861 CAATATGCATTCTGTCTTAATGG + Intronic
1036562999 8:9913434-9913456 GACTATGTTTACTCTCTTAAGGG + Intergenic
1037215198 8:16442542-16442564 TAATATTTAATCTCAATTAATGG + Intronic
1038053292 8:23833522-23833544 GAATCTGTACTCTCTCATAAAGG - Intergenic
1038054009 8:23840817-23840839 GTACATGAATTGTCACTTAAGGG - Intergenic
1041038693 8:53823177-53823199 GAAGATGTATTCTTTCTTAAGGG - Intronic
1041719698 8:60964879-60964901 GATTTTATATTCCCACTTAATGG + Intergenic
1041858969 8:62489351-62489373 GAATATATATTTTCATTTAATGG - Intronic
1042037391 8:64550189-64550211 GAATTTGTACTTTCACTTTACGG - Intergenic
1046121426 8:109852128-109852150 GAATATTTATACTTTCTTAAAGG - Intergenic
1046584454 8:116134063-116134085 GAATCTGCTTTCTCTCTTAAAGG + Intergenic
1047066578 8:121291135-121291157 GAATATGTTTTCTAACTGATGGG + Intergenic
1051288580 9:15522134-15522156 TAATATGAATTTTAACTTAAGGG - Intergenic
1052252677 9:26417704-26417726 GAATAAGAATTCTAATTTAAGGG + Intergenic
1052389494 9:27862542-27862564 GAATATGTATCCACAATTTAAGG + Intergenic
1053484277 9:38440099-38440121 TAACATGTATTCCCACTTCACGG - Intergenic
1053684954 9:40512199-40512221 GAAGATCTTTTCTCCCTTAATGG + Intergenic
1054278775 9:63112757-63112779 GAAGATCTTTTCTCCCTTAATGG - Intergenic
1054298045 9:63347662-63347684 GAAGATCTTTTCTCCCTTAATGG + Intergenic
1054396063 9:64652180-64652202 GAAGATCTTTTCTCCCTTAATGG + Intergenic
1054430706 9:65157375-65157397 GAAGATCTTTTCTCCCTTAATGG + Intergenic
1054499675 9:65864146-65864168 GAAGATCTTTTCTCCCTTAATGG - Intergenic
1055269621 9:74543242-74543264 AAACAAGTATTCTCACTTGAGGG - Intronic
1055722267 9:79188619-79188641 AAACATGTATTATCACTTGATGG - Intergenic
1057244877 9:93446585-93446607 GTATATATATTCTCTCTTAAGGG - Exonic
1057712453 9:97458761-97458783 GAATATGTAGTCAGACTAAAAGG + Intronic
1058165700 9:101616654-101616676 AAAAAGGTATTCTCACTTATAGG + Intronic
1059000852 9:110347428-110347450 GAATCAGTATTTTCACTTACAGG + Intergenic
1059232309 9:112732326-112732348 GAAAATGGACTCTCACTAAAGGG - Intergenic
1060798536 9:126528570-126528592 GAATTTGCCTTCTCACTTAAAGG - Intergenic
1061921698 9:133786114-133786136 GCATATGTATTCTCACGTGAGGG - Intronic
1062225548 9:135447615-135447637 GAAAATGTTTTTTCTCTTAAGGG - Intergenic
1185807305 X:3070370-3070392 GAATTTTTATTCTAATTTAAGGG - Intronic
1186044769 X:5523451-5523473 GAACATGCATTTTCATTTAAAGG + Intergenic
1186174883 X:6915836-6915858 TAATATGTGATCTCACTTAATGG + Intergenic
1186787180 X:12964453-12964475 AAATATGTATTCTCTCTTTCTGG + Intergenic
1187060594 X:15783268-15783290 GAATGTGTATTCTTTCATAAGGG + Exonic
1188176455 X:26996524-26996546 AAATGTGAATTCTCAATTAATGG + Intergenic
1188627797 X:32308428-32308450 GAATATGTATTTCCTGTTAAAGG - Intronic
1188779557 X:34264283-34264305 TAATACGTATTCTCTATTAATGG - Intergenic
1189091630 X:38089426-38089448 GAATATGCTTTCTCATTTAGGGG + Exonic
1190555461 X:51629755-51629777 GACTATTTTTTCTCCCTTAAAGG + Intergenic
1193525810 X:82587134-82587156 GAATATGAATACTGATTTAAGGG - Intergenic
1193547472 X:82847290-82847312 GAATATTTATTTTCAATGAATGG - Intergenic
1194378147 X:93161449-93161471 TAATATTTATTACCACTTAAAGG + Intergenic
1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG + Intergenic
1195177306 X:102323289-102323311 GAATCTGTATTCTGACTCCAGGG - Intronic
1195181558 X:102363804-102363826 GAATCTGTATTCTGACTCCAGGG + Intronic
1195234719 X:102885428-102885450 AAATATGCATTCTCATTCAAGGG + Intergenic
1195606985 X:106817056-106817078 AAATCTGTATTCTAAATTAAAGG + Intronic
1195927721 X:110042953-110042975 GAGTTTGTATTCTCAATTAGGGG + Intronic
1197134391 X:123044191-123044213 GAATGTGGATTCTTACTTAAAGG - Intergenic
1201271510 Y:12260001-12260023 GAATTTTTATTCTAATTTAAAGG + Intergenic