ID: 944165761

View in Genome Browser
Species Human (GRCh38)
Location 2:196718598-196718620
Sequence CCCTGTCCTCCACAGCCTCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944165761_944165764 -6 Left 944165761 2:196718598-196718620 CCTCGAGGCTGTGGAGGACAGGG 0: 1
1: 0
2: 1
3: 22
4: 273
Right 944165764 2:196718615-196718637 ACAGGGAAAACAAGAAGGCAAGG 0: 1
1: 0
2: 3
3: 78
4: 739

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944165761 Original CRISPR CCCTGTCCTCCACAGCCTCG AGG (reversed) Exonic
900182851 1:1320014-1320036 CCCTGTCCTCCCCAGCAGCCAGG - Intronic
900388080 1:2419675-2419697 CCCTGGCATCCACAGACCCGGGG + Intergenic
900523942 1:3119425-3119447 CCCTGGCCTCCACAGCCGCCTGG + Intronic
900626081 1:3609275-3609297 CCCTGCACTCCACAGCCCAGTGG + Intronic
900681461 1:3919144-3919166 CCCTGTCCTCCAGCGCCGCTCGG - Intergenic
901197174 1:7446794-7446816 CCCTCCCCTCCACAGCCCCGGGG - Intronic
901286813 1:8086886-8086908 CCCTGTCCTCCTCAGTGTGGAGG + Intergenic
901784583 1:11616399-11616421 CCCTGTCACCCACAGCCGCCTGG + Intergenic
902158108 1:14506122-14506144 GCCTGTCCTCCTCACCCTCTAGG - Intergenic
902804835 1:18854527-18854549 CCCGGTCCTGCACAACCTCACGG - Exonic
902840080 1:19068824-19068846 CCCTGCCCTCCAGAGCATCAGGG - Intergenic
902881571 1:19375032-19375054 CCCTCTGCTCCAAAGCCACGGGG + Intronic
904625226 1:31798594-31798616 CCCTGGCCTCCACAGCCTTCGGG - Exonic
904941618 1:34167495-34167517 CCCTGCCCTCCACAGCCCCCAGG - Intronic
907489736 1:54801199-54801221 CACTGCCCTCCACAGCCTCAGGG - Exonic
909235960 1:73152877-73152899 CCCTGCTCTCTGCAGCCTCGGGG - Intergenic
910438044 1:87225623-87225645 CCTTGGGCTCCACAGCCTAGAGG - Intergenic
913093250 1:115494184-115494206 CCCTGCCCTTCACAGCCTTGAGG + Intergenic
913451393 1:118994986-118995008 CCCTGACCTCGGCAGCCTGGAGG - Intergenic
915873562 1:159587945-159587967 CTCTGTCCTCACCAGCCTCCTGG + Exonic
916418664 1:164615934-164615956 CCCTGGCCTCCCCAGACTCCTGG - Intronic
916480432 1:165209622-165209644 CCCTGTGCACCCCAGCCTCCAGG - Intronic
918302782 1:183219127-183219149 CCCTCTGCTCAACAGCCTCTGGG - Intronic
919708686 1:200704598-200704620 ACCTGTCATCCACAGCTTTGAGG - Intergenic
919709774 1:200714433-200714455 CCCTGACATCCACATCCTCCAGG - Intergenic
921187750 1:212684716-212684738 CCCTCTCCTCCCCAGCCTCCCGG + Intergenic
922621926 1:226995170-226995192 TCCTGTCCACCCCAGCCACGGGG + Intronic
924520634 1:244803095-244803117 CCCTGGCCTCTACAGCACCGAGG + Intergenic
1063266637 10:4458691-4458713 CCCTTTTCTCCACAACCTCAAGG + Intergenic
1065808654 10:29420597-29420619 CCCTGTCATCCGCAACCACGTGG + Intergenic
1067527918 10:47049497-47049519 CTTTCTCCTCCACAGCCTGGTGG + Intergenic
1068156419 10:53205404-53205426 TTCTGTCCTCCACAGGCTCTGGG - Intergenic
1069659906 10:70116793-70116815 CCCTGTCCCCACCAGCCTCCTGG - Intronic
1070329128 10:75405483-75405505 CCCTGTCCTGCCCCGCCTCGCGG + Intergenic
1071163305 10:82777701-82777723 CTCTGTCCTCCACTGCTTCCAGG - Intronic
1071808291 10:89148523-89148545 CCCTTTTCTCCACAGCCTCACGG + Intergenic
1073060940 10:100733268-100733290 CCCTGTCCTGCACTGTCTCTTGG - Intergenic
1075101619 10:119510231-119510253 AACTGTCTACCACAGCCTCGGGG + Intronic
1075736478 10:124667555-124667577 CCCGGTCCTCCTCAGCCCTGTGG - Intronic
1075741470 10:124698876-124698898 ACCTCTCCTCCACAGCCTACAGG + Intronic
1076387384 10:130067108-130067130 CCTTCTCCTCCACACCCTTGGGG + Intergenic
1076755881 10:132571389-132571411 CCTTGTCCTCCCCAGCTGCGGGG + Intronic
1077064744 11:636181-636203 CCGTGTCCTCCAGACCTTCGAGG + Intergenic
1077226949 11:1442746-1442768 CCCAGTACCCCACAGCCTGGTGG + Intronic
1078369919 11:10735985-10736007 CCCTTGCCTACACAGCCCCGGGG + Intergenic
1079341647 11:19616623-19616645 CCCTGTCCTCCCCATCATCAGGG - Intronic
1080322600 11:31030660-31030682 CCCTGACCTCCACGGCTTTGCGG + Intronic
1081453354 11:43195087-43195109 CCCTGTACTACACAGCCCTGGGG + Intergenic
1083764973 11:64837314-64837336 TCCTGTCCTCGACAGCCCTGGGG - Intronic
1084423421 11:69071784-69071806 CCCAGTTCCCCACAGCCTGGGGG - Intronic
1085030235 11:73266663-73266685 CCTTGTCCTCCAAGGCCTCCGGG - Intronic
1085121484 11:73970167-73970189 CCCTACCCGCCACAGCCTCAGGG + Exonic
1085224497 11:74907331-74907353 CCCTGTCCTCCATGGCTTCCTGG - Intronic
1086570971 11:88283946-88283968 CCCAGGCCTCCCCAGCCACGTGG + Intergenic
1089344046 11:117778768-117778790 CTCTGGCCTCCACAGCGTGGAGG - Intronic
1090186641 11:124743305-124743327 CCCACTCCTCCACAGCTGCGAGG + Intronic
1091596632 12:1883016-1883038 CCCTGCCTTCCACACCCACGCGG - Intronic
1091782739 12:3224279-3224301 CTCGGTCATCCACAGCCTCCCGG - Intronic
1094479327 12:30869316-30869338 CCCTCTCCTCCTCAACCTAGAGG - Intergenic
1097187414 12:57203166-57203188 CCCTGTCCTTCCCAGCCCCTCGG + Exonic
1097396814 12:59085166-59085188 CCCTGGCCTCCGCATCCTCGCGG + Intergenic
1097896756 12:64832154-64832176 CCCTGTCCTGCTCAGCCTCCTGG - Exonic
1102269541 12:111521331-111521353 TCCTGTCCTCCACAGACCTGAGG - Intronic
1104461758 12:128962130-128962152 CCCTGTCCCCCTCGGCCTCCTGG + Intronic
1105426197 13:20297054-20297076 CCCTGTCCTCCTCTCCCTCTAGG + Intergenic
1108684200 13:52804698-52804720 CCCTCTCCTCCACACCCACAGGG + Intergenic
1112103806 13:96218541-96218563 CCCTGTCACTCACAGCCACGTGG + Intronic
1113735092 13:112672712-112672734 CCCAGTGCCCCACAGCCTGGGGG + Intronic
1113932993 13:113978210-113978232 CCCTGCCCTGCACAGCATCTGGG + Exonic
1114637324 14:24195316-24195338 CCCTTCCCGCCACAGCCCCGGGG + Intronic
1115163701 14:30424493-30424515 TCCTCTCCTCCACAGCTTCATGG - Intergenic
1115783758 14:36801160-36801182 CCCTTGCCTCCTCAGCCTCAAGG + Intronic
1116790012 14:49330042-49330064 ACATGTCCTCCACAGCATCCAGG + Intergenic
1118895343 14:69941143-69941165 CCCTGCCCTACCTAGCCTCGTGG + Intronic
1119719917 14:76883706-76883728 CCCTGACCTCCACAGGCTGCAGG + Intergenic
1120521869 14:85533837-85533859 CCCTGTCGCCCGCAGCGTCGGGG - Intronic
1120593496 14:86405049-86405071 CCCTGTCCTCCACCAACTCTGGG + Intergenic
1122165690 14:99821985-99822007 CACAGTCTTCCACAGCCACGTGG - Intronic
1122269533 14:100562354-100562376 CCCTGTCCTAGACAGCATCCAGG - Intronic
1122621467 14:103059783-103059805 CCCTCCCCTCCACAGCCACCAGG - Intergenic
1122691282 14:103533180-103533202 CCCTGGGCTCCAGAGCCTGGGGG - Intronic
1122917922 14:104867307-104867329 CCCTGTCCTGCTGAGCCTGGAGG + Intronic
1123016181 14:105376803-105376825 CCAGGTCCTCCTCTGCCTCGGGG - Exonic
1123125960 14:105946131-105946153 CCCTGCCTGGCACAGCCTCGGGG + Intergenic
1123143397 14:106105273-106105295 CCCTGTCCCCCACACCCACAGGG - Intergenic
1123191485 14:106576270-106576292 CCCTGTCCCCCACACCCACAGGG - Intergenic
1125503556 15:40253655-40253677 CCCTGCCCTGCACAGCCACTGGG - Intronic
1127335464 15:57979510-57979532 CCTTCTCCTCCACAGCCTGGTGG + Intronic
1128062782 15:64745811-64745833 CCCAGGCCTCCACAGCTACGTGG - Intronic
1129524056 15:76203019-76203041 CCCAGTCCTCCACAACTTTGGGG + Intronic
1131179099 15:90228142-90228164 CCCCGTCCTCCACCACCTCTGGG - Exonic
1132866000 16:2093084-2093106 CCCCGTCCACCAGAGCCTCCTGG - Exonic
1133076630 16:3285217-3285239 CCCTCTCCTTTACAGCCTGGGGG - Exonic
1133582464 16:7159269-7159291 CCCTCTCCTGCTCAGCCTCAGGG - Intronic
1134179589 16:12036727-12036749 ACCTGTGCTCCACAGCCATGCGG - Intronic
1134294659 16:12935098-12935120 CCCTGTCCTTCCCAGCCAAGGGG - Intronic
1135306326 16:21370494-21370516 ACCTGTGCTCCACAGCCATGGGG - Intergenic
1136285109 16:29236286-29236308 CCCAGTTCTCCACACCCTCTCGG - Intergenic
1136303071 16:29349635-29349657 ACCTGTGCTCCACAGCCATGGGG - Intergenic
1136518582 16:30782428-30782450 CTCTGCCCTCCGCAGCCCCGGGG + Exonic
1138028657 16:53541934-53541956 CTGTTTCCACCACAGCCTCGGGG + Intergenic
1138715376 16:59016264-59016286 GCCTGTGCTCCACTGCCTCAGGG - Intergenic
1139477168 16:67208559-67208581 CCCCGTCCTCCAAGACCTCGAGG + Intronic
1139692618 16:68650812-68650834 CCCCTTCCCCCACAGCCTGGTGG + Intronic
1140974178 16:80043545-80043567 CCCTGTTCTACACAGGCTCCCGG - Intergenic
1141926427 16:87173325-87173347 CCCTGCACTACACAGCCTCTGGG + Intronic
1142033568 16:87850406-87850428 CCCTGTCCTCTGCAGCCCTGGGG + Intronic
1142090176 16:88205910-88205932 CCCAGTTCTCCACACCCTCTCGG - Intergenic
1142218048 16:88839500-88839522 CCCTGCCCTGCACACCCGCGTGG + Intronic
1143104956 17:4524955-4524977 CCCTTTGCTCCACAGACTCTTGG + Intronic
1143450307 17:7032339-7032361 CTCTGTCCTCCAAGGCCTCTGGG + Intergenic
1143697381 17:8630541-8630563 TCCTGTCCTCCAGAGCCGCCCGG + Intronic
1143771753 17:9173518-9173540 CCCTGACCTCCACAGCAGCCAGG + Intronic
1144701952 17:17346142-17346164 CCCCACCCTCCCCAGCCTCGTGG + Intronic
1146675732 17:34772616-34772638 CTCTGTCCTCCTCCTCCTCGAGG + Intergenic
1147567358 17:41546027-41546049 CCCTGCCTTCCCCAGCCTCCAGG - Intergenic
1149398543 17:56270371-56270393 CTCTGTCCTGCCCAGCCTCCAGG + Intronic
1150283868 17:63944859-63944881 CCCTGCCCCCCACAGCCCTGAGG + Intronic
1151564555 17:74890532-74890554 GCCTTTCCTCCCCAGCTTCGAGG + Intronic
1151604749 17:75129342-75129364 CACTGTCCTGCAAAGCCTCTGGG - Exonic
1152077348 17:78168068-78168090 CACTGCCCTTCACAGCCTTGGGG + Intergenic
1152261268 17:79268601-79268623 CCCTGGCCTGCACATCCTCCTGG + Intronic
1152603902 17:81279189-81279211 CCCTGACCTCCAGGGCCTCCTGG + Intronic
1152639530 17:81443843-81443865 TCCTCTCCTCCTCAGCCTCCAGG - Exonic
1152644530 17:81462725-81462747 CCATGTCCCCCACAGCGGCGTGG + Exonic
1156411016 18:36828639-36828661 CCTTCTCCTCCACACCCTCTCGG + Intronic
1156419297 18:36933637-36933659 TTCTGTCCTCCACACCCTCTGGG + Intronic
1157618153 18:48999869-48999891 CACTGTCCACCACAGCCAAGGGG - Intergenic
1159331898 18:67005649-67005671 TCCTTTCCTTCACAGCCTCTAGG + Intergenic
1160769867 19:825773-825795 CCGTGTCCCCCACACCCTTGGGG - Intronic
1161014173 19:1975311-1975333 GCTTGTCCTCCTCAGCCTGGGGG + Intronic
1162301426 19:9847293-9847315 CCCTGGCCTCCTCCGCCTCCTGG + Intronic
1162683642 19:12364801-12364823 CCCTGAGCCCCACTGCCTCGCGG + Exonic
1162804273 19:13128926-13128948 CCTTGTCCCCCACACCCTCAGGG + Intronic
1163425044 19:17236371-17236393 CCCTCCCCTCCAAAGCCTCCAGG + Intronic
1163523883 19:17808499-17808521 TGCTGTCCTCACCAGCCTCGTGG + Intronic
1163778034 19:19229344-19229366 CTCTGTCTTCCTCAGACTCGGGG - Intronic
1164452693 19:28380654-28380676 CCCTGTCCCCCACCGCCACCTGG - Intergenic
1164475155 19:28569911-28569933 CCCTGTGCTCCAGAGACTCCTGG - Intergenic
1164813628 19:31177419-31177441 CCCTTGCCTTCCCAGCCTCGGGG + Intergenic
1165357186 19:35311602-35311624 CCCTCTGCTCCACATCCTGGTGG + Intronic
1166201100 19:41238457-41238479 CCCTGTCCTCCAGTGCCCCTGGG + Exonic
1167445863 19:49537225-49537247 CCCTGTCCCCCACACCCTTCCGG + Intronic
1167511160 19:49896009-49896031 CCCCATCCTCCTCAGCCTGGTGG - Exonic
925000783 2:401271-401293 TCCCATCCTCCACAGCCTGGAGG - Intergenic
926143938 2:10385375-10385397 CCCTGTCCCACACAACCTCCAGG - Intronic
926163817 2:10505647-10505669 CCCTCTCCTGCATAGCTTCGTGG - Intergenic
927146292 2:20168616-20168638 ACCTGCCCGCCAGAGCCTCGGGG - Intergenic
929756448 2:44769438-44769460 CCCTCTCCTCCCCAGCCTTTTGG + Intronic
929942743 2:46347306-46347328 CCGTGTTCTCCACAGCCTCTGGG - Intronic
930724598 2:54670424-54670446 CCCTGGGCTCCACAGCTGCGTGG + Intronic
931263225 2:60638291-60638313 CCCTGGCCCCCTCAGCCTGGGGG - Intergenic
931300300 2:60973038-60973060 CCCTGTGCTCCACATCCCCGAGG + Intronic
931391652 2:61849811-61849833 TCATGTCCTTCACAGCCACGTGG + Intronic
932259429 2:70314628-70314650 CTCTGTCCTCCCCATCCTCTGGG + Intergenic
933114024 2:78443915-78443937 CCCTCCCCTCCCCAGCCTCTTGG + Intergenic
936082294 2:109440697-109440719 CTCTGATCTCCACATCCTCGGGG - Intronic
937150411 2:119682305-119682327 CCCTGACTCCCACAGCCTGGTGG - Intronic
939983923 2:148812243-148812265 CCCTGCCCTGCACAGCCCCAGGG + Intergenic
940011747 2:149061611-149061633 CCCCATCCTCCAAAGCCCCGGGG - Intronic
941590609 2:167416192-167416214 CTCTGTCCTCCTAAGCCTCTGGG - Intergenic
943669696 2:190648476-190648498 CCCTGGCCCCCGCAGGCTCGGGG - Intronic
944165761 2:196718598-196718620 CCCTGTCCTCCACAGCCTCGAGG - Exonic
944672973 2:202011283-202011305 CCCAGTCCTCCACAGACCAGAGG + Intergenic
947453011 2:230225604-230225626 CCCTGTCTTCCGTGGCCTCGTGG + Intronic
947910766 2:233799393-233799415 CGCTTCCCTCCACAGCCTCCAGG - Intronic
948167657 2:235875469-235875491 CCCTGAGCCGCACAGCCTCGTGG - Intronic
948949323 2:241238876-241238898 CCCTGTCCTCTACAGCCACTTGG + Intronic
1169211336 20:3767676-3767698 CCCTGCCCTCCCCGGCCCCGGGG - Exonic
1169392567 20:5202441-5202463 CTCCCTCCCCCACAGCCTCGAGG - Intergenic
1170474045 20:16697210-16697232 CTCTGTGCTCCCCAGCCTCTAGG + Intergenic
1172113880 20:32562712-32562734 CCTTGACCTCCACAGCTTCCCGG + Intronic
1173059180 20:39645480-39645502 CCCTGGCCTCAAAGGCCTCGGGG - Intergenic
1173248508 20:41352265-41352287 CCCTGCCCTCCCCATCCTCTGGG - Intronic
1173531265 20:43771577-43771599 CCCTTTCCTCCACTGCCCCTGGG + Intergenic
1173644535 20:44625459-44625481 CCCTGTGCCCCACAGCCCCATGG - Intronic
1174281642 20:49444211-49444233 CCCTGTCCTCCCCAGACATGAGG + Intronic
1174291649 20:49513190-49513212 CCAGGTCCACCACAACCTCGCGG + Exonic
1174418905 20:50386391-50386413 CACTGTCCTCAACAGCCAAGAGG - Intergenic
1174617309 20:51845694-51845716 CACAGTCCACCACAGCCTCCTGG + Intergenic
1175164431 20:57033274-57033296 CCCTGTCCTCCACCCGCTAGAGG - Intergenic
1175246106 20:57583037-57583059 CCCTGCCCTCCACAGCCAGGAGG - Intergenic
1175311528 20:58015061-58015083 CCCTGTTATCCAAAGCCTCCTGG - Intergenic
1175415446 20:58797628-58797650 CTCTGGCCTCCCCAGCCTCAGGG - Intergenic
1175482391 20:59320820-59320842 CCCTGCCCTCCACAACCCCCAGG - Intronic
1175924780 20:62466329-62466351 CCCGCTCCTCCCCAGCCTCTTGG + Intronic
1176056803 20:63153082-63153104 CCTTGTCCTCCACGTCCTCCCGG - Intergenic
1179888986 21:44326401-44326423 CCCTGCTCTCCACGGCCTGGCGG - Intronic
1180140652 21:45891834-45891856 CCTTCTCCTGCACAGCCCCGGGG + Intronic
1180155811 21:45977055-45977077 CCCTGCCCTCCCCTGCCTCCCGG + Intergenic
1180655013 22:17413027-17413049 CCCTGTCCTCCACCCTCTCTTGG + Intronic
1180877118 22:19179702-19179724 CCCTGGCCTCCCCAGGCTCTGGG + Exonic
1181620041 22:24084798-24084820 CCCTGTCCCCCACGTCCTCAAGG - Intronic
1182431989 22:30304623-30304645 CCCTCTGCTCCACAGGCTGGAGG - Exonic
1184014915 22:41778693-41778715 CCTTGTTCTTCACAGCCTCGGGG + Exonic
1184097759 22:42325706-42325728 CCCTGTCCTGCGTAGCCTCAGGG - Intronic
1184583298 22:45431115-45431137 CCTTGACCTCCACAGCCCCGCGG - Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1184795174 22:46728018-46728040 CCCTGCCCTCCAGAACCTCCTGG - Intronic
1185074442 22:48675788-48675810 CCCTGTCCTCCCCAGTCTCCAGG + Intronic
1185394914 22:50581965-50581987 GCCTGTGCTCCAGAGCCTCCAGG - Intronic
952541239 3:34370509-34370531 CACTTTCCTCCTCAGCCTCTGGG - Intergenic
953606616 3:44416829-44416851 CCCTGTCCTCCAAACACTTGTGG - Intergenic
953911559 3:46895820-46895842 CCTTGTCCTCCTCAGACTCAGGG - Exonic
953972049 3:47355568-47355590 CCCTGTCCTGCACAGTCCGGGGG - Intergenic
954575114 3:51671532-51671554 CCCTCACCTCCACGGCCCCGGGG - Exonic
955484785 3:59424441-59424463 CACTGTCCCTTACAGCCTCGGGG - Intergenic
958108483 3:89107787-89107809 CTCTGTTCTCGACAGCTTCGGGG + Exonic
958506731 3:94988492-94988514 CCGTGTCCTCCACACCATCTAGG + Intergenic
960715632 3:120572338-120572360 CCGTTTCCTCCAAAGCCTTGAGG + Intergenic
963775573 3:149435804-149435826 CCATGTTCTCCACAGCCTTATGG - Intergenic
966775063 3:183536441-183536463 CCCTGCCCTCCCCAGGCTCCCGG - Intronic
967983766 3:195080616-195080638 CACTGTCCCCGACAGCCTCATGG + Intronic
968480334 4:830365-830387 CCCTTTCCTCCACAGCCTCTGGG - Intergenic
968585813 4:1415452-1415474 CCCTCCCCCTCACAGCCTCGTGG + Intergenic
968665876 4:1822136-1822158 CCATGCCCTCCTCAGCCTCCAGG + Intronic
968843809 4:3028304-3028326 CCCTGTGCACCACGGCCTCTCGG + Intronic
968968695 4:3782312-3782334 CCCTGGGCTTCACAGCCTCGAGG + Intergenic
968984949 4:3869999-3870021 CGCTGTCCTGGATAGCCTCGTGG + Intergenic
969489693 4:7491983-7492005 CCCTGCCCTGCCCAGCCTCCAGG - Intronic
969689873 4:8698535-8698557 CCCTGCCCTCCTCTGCCTCCTGG - Intergenic
970388469 4:15581498-15581520 CCCTGTGTCCCACAGCCTTGTGG - Intronic
970394895 4:15655663-15655685 CCCTGCCCACCACGGCCTTGAGG + Intronic
971389380 4:26171871-26171893 CCCTGTCATCAGCAGGCTCGGGG + Intronic
971600140 4:28581982-28582004 CTCTGTCCTCCTGAGCCTCTGGG - Intergenic
972638010 4:40901400-40901422 CCCTGTCCCCCACCACCTAGGGG - Intronic
977368680 4:96105717-96105739 CACTGTCCTCTATAGCCTAGAGG + Intergenic
983524259 4:168744396-168744418 GCACATCCTCCACAGCCTCGAGG + Intronic
984923311 4:184784802-184784824 CTGTGTCCTCCTCAGCCACGTGG - Intronic
985524431 5:394871-394893 CCGAGTCCTCCCCAGCCTGGGGG + Intronic
986226686 5:5822307-5822329 CTGTGTCCTCCAAAGCCACGGGG + Intergenic
986454254 5:7899670-7899692 CCCAATCCTCCACAGGCTCCAGG - Intronic
986722074 5:10566498-10566520 CCCTGTCCTGGGCAGCCTGGTGG + Intronic
988469718 5:31526856-31526878 CCATGTCCTCCTCGTCCTCGGGG + Exonic
988524959 5:31978899-31978921 CCCTGTCCTCTCCAGCTTCCTGG - Intronic
989766646 5:45092907-45092929 TCCTGACCTCTACAGCCTGGTGG - Intergenic
993187285 5:84636025-84636047 CCCTGTGCCCCACATCCCCGAGG - Intergenic
993761667 5:91803059-91803081 TCCTGTCATCCACAGCCTCATGG - Intergenic
998133996 5:139665273-139665295 CCGCGGCCTCCTCAGCCTCGCGG + Intronic
998166449 5:139847186-139847208 TCCTGTCCCCCACAGCCTCCAGG - Intronic
1001096597 5:168780160-168780182 CCATGTCCTCCACAGACCCTTGG - Intronic
1001971684 5:175960292-175960314 CTCTGTCCTCCACTGGCTTGTGG - Intronic
1002424975 5:179169560-179169582 CCCTGTCCTCCTGAGCATCTGGG - Intronic
1003169901 6:3712965-3712987 CCCTGCCCTCCACAGTCCCCAGG + Intergenic
1004546572 6:16603787-16603809 CCCTGTACCCCACAGCCACCAGG - Intronic
1004999814 6:21229624-21229646 TCCTGTCCTGCACCGCCTCTGGG + Intronic
1007081696 6:39109741-39109763 TCCTGTCATCCACAGCCATGTGG - Intronic
1008657534 6:53631013-53631035 CCCTGTCCACCACAGCCAGCTGG + Intergenic
1013391708 6:109691619-109691641 CCCTGTCAAACACAGCCTTGGGG + Intronic
1014741669 6:125154252-125154274 CCCTGGCCTTCCCAACCTCGCGG + Intronic
1017945864 6:159095805-159095827 GCCTGTCCTTCACAGCCCCATGG - Intergenic
1018994214 6:168698986-168699008 TCCTTTCCTCCACAGCTTGGAGG + Intergenic
1019404168 7:875023-875045 ACCTGTCCTCCAAGGCCTTGAGG + Intronic
1020274159 7:6615074-6615096 GCCTGCCCTCCCCAGCCCCGGGG + Intergenic
1023592763 7:41796675-41796697 CCCTGTTATCCTCAGCCTAGGGG - Intergenic
1025252108 7:57358605-57358627 CACTGTCCTCAACAGCCAGGAGG + Intergenic
1026805703 7:73428883-73428905 CCCTGACCTCCCCAGGCTCATGG + Intergenic
1026851431 7:73725986-73726008 ACCTGTCCTCCAGAACCTCTGGG + Intergenic
1029258179 7:99283579-99283601 CCTTGTCCTCCTCAGCCTGTAGG - Intergenic
1029278248 7:99420258-99420280 CCCTGTCCTCTGCAGCCACCTGG - Intronic
1029437895 7:100573011-100573033 CTCTGTCCTCCTCACCCTAGGGG - Exonic
1029444013 7:100603041-100603063 CCCTCCCCCCCACCGCCTCGTGG + Intronic
1029692553 7:102191893-102191915 CCCTCTCATCCACAGCCTGCCGG + Intronic
1032521666 7:132550201-132550223 CCCTGACCCCCACAGCATGGTGG + Intronic
1032521727 7:132550654-132550676 CCCTGTCCTCCCCTCCCTCAAGG + Intronic
1033356107 7:140601692-140601714 TCCTGTCCTCCACAAGCTCAGGG + Exonic
1034983906 7:155496065-155496087 ACCTGTCCTCCAAGGCCTCCGGG + Intronic
1035198859 7:157246797-157246819 ACCTGTTCTCCACACCCCCGGGG + Intronic
1035328703 7:158082727-158082749 CCATGTCCACCACTGCCTCTTGG + Intronic
1037951189 8:23019560-23019582 CCCTTTCGTCCACAGCTTCCGGG - Intronic
1039496762 8:37986224-37986246 CCCTGTACCCCACAGGCTAGGGG + Intergenic
1042206010 8:66330398-66330420 CTCTGACCTTCACAGCCTAGCGG + Intergenic
1043712711 8:83442169-83442191 CCCTTTTCTCTACAGCCTTGTGG + Intergenic
1044618941 8:94170276-94170298 CCATGTCTTCCACAGCATAGAGG - Intronic
1047027902 8:120844656-120844678 CCTTGACCTCCCCAGGCTCGAGG + Intergenic
1048042583 8:130745660-130745682 CCCTGCTCTCCACACCCTCCTGG - Intergenic
1048351517 8:133620326-133620348 CACTGGCCTCAACAGCCTCTTGG - Intergenic
1048974657 8:139664412-139664434 CCCTCCCCTACACAGCCTCTAGG + Intronic
1049104549 8:140603753-140603775 CCCAGTCCGCCACAGCAGCGTGG - Intronic
1049191121 8:141288215-141288237 CGCTGCCCTTCAGAGCCTCGAGG + Intronic
1049624803 8:143615176-143615198 CCCTGACCTCAGCAGCCTCCTGG - Intronic
1049654134 8:143790322-143790344 CCCTGGCCTCACCAGCCTCATGG + Intergenic
1050051098 9:1602393-1602415 CCCAGTCCTCCTCAGACTCAAGG - Intergenic
1051538824 9:18191342-18191364 GCCTGTCCTCCTCAGTCTCAAGG - Intergenic
1052325758 9:27215288-27215310 CCCTTTCCTCCCCAGCCCCAAGG - Intronic
1055925688 9:81507734-81507756 CCCTGTACTCCTCAGCCTTTGGG - Intergenic
1057198732 9:93129369-93129391 GCATCTGCTCCACAGCCTCGTGG - Intronic
1059401133 9:114071223-114071245 CCCTGCCCACCACAGACTCTAGG + Intronic
1061221369 9:129253966-129253988 CCTGGTTATCCACAGCCTCGCGG + Intergenic
1062516651 9:136940213-136940235 CCCTGTCCTCCATGACCTCCAGG - Intronic
1186792239 X:13010616-13010638 GCCTGTCCTCCACAATCTTGGGG - Intergenic
1188516904 X:30997601-30997623 CTTTGTGCTCCACAGCCTCTAGG + Intergenic
1188757934 X:33987349-33987371 CCCTGTCCTCCCCAGCAGCAGGG - Intergenic
1190775734 X:53551045-53551067 CACTGTCCTCCATATCCTCTAGG + Exonic
1192447415 X:71221479-71221501 CCCTTTCCTCTACAGCATAGAGG + Intronic
1195306192 X:103585983-103586005 AACTCTCCTCCCCAGCCTCGCGG - Exonic
1199992324 X:152994118-152994140 CTCTTCCCGCCACAGCCTCGTGG - Intronic