ID: 944172976

View in Genome Browser
Species Human (GRCh38)
Location 2:196799736-196799758
Sequence CTGCAGCTGCGGCGCAGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944172976_944172985 21 Left 944172976 2:196799736-196799758 CCCGGTCTGCGCCGCAGCTGCAG 0: 1
1: 0
2: 2
3: 16
4: 183
Right 944172985 2:196799780-196799802 CCAGACCGGGACGTATAAATGGG 0: 1
1: 0
2: 0
3: 0
4: 19
944172976_944172983 20 Left 944172976 2:196799736-196799758 CCCGGTCTGCGCCGCAGCTGCAG 0: 1
1: 0
2: 2
3: 16
4: 183
Right 944172983 2:196799779-196799801 GCCAGACCGGGACGTATAAATGG 0: 1
1: 0
2: 0
3: 1
4: 32
944172976_944172986 24 Left 944172976 2:196799736-196799758 CCCGGTCTGCGCCGCAGCTGCAG 0: 1
1: 0
2: 2
3: 16
4: 183
Right 944172986 2:196799783-196799805 GACCGGGACGTATAAATGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 28
944172976_944172980 7 Left 944172976 2:196799736-196799758 CCCGGTCTGCGCCGCAGCTGCAG 0: 1
1: 0
2: 2
3: 16
4: 183
Right 944172980 2:196799766-196799788 GTTCCGCGTGCGCGCCAGACCGG 0: 1
1: 0
2: 0
3: 1
4: 27
944172976_944172981 8 Left 944172976 2:196799736-196799758 CCCGGTCTGCGCCGCAGCTGCAG 0: 1
1: 0
2: 2
3: 16
4: 183
Right 944172981 2:196799767-196799789 TTCCGCGTGCGCGCCAGACCGGG 0: 1
1: 0
2: 0
3: 3
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944172976 Original CRISPR CTGCAGCTGCGGCGCAGACC GGG (reversed) Intergenic
901084772 1:6603595-6603617 CTGCAGCTGCGACGCAGACTCGG - Intronic
903497348 1:23778548-23778570 CTGCCGCTGCGCCGCCGAACGGG + Exonic
905960027 1:42035707-42035729 CGGGAGCTGCGGCGCTGACACGG + Intronic
906041150 1:42788620-42788642 CTGCTGCTGCCTCGCAGGCCTGG + Intronic
906207526 1:43995157-43995179 CTGCAGGTGAGCCGCAGCCCTGG + Exonic
907394028 1:54177246-54177268 CTGCAGCTGTGGCCCAGGCAGGG + Intronic
910237336 1:85048744-85048766 CGGCAGCTCCGGAGCAAACCTGG - Intronic
911048435 1:93648876-93648898 CTGCAGGAGTGGTGCAGACCAGG - Intronic
912408948 1:109466739-109466761 CTGCAGGTCCGGGGCAGAGCAGG - Exonic
913300735 1:117366935-117366957 CAGCAGCTGCTGCGCTCACCAGG + Intergenic
917967512 1:180187796-180187818 CTGCTACTGCGGGGCATACCTGG - Intronic
918046622 1:180945415-180945437 CTGCAGCTGCAGCGCTCCCCAGG + Exonic
919830865 1:201539297-201539319 GCGCGGCTGCGGCGCGGACCCGG + Intergenic
919987756 1:202687728-202687750 CAGCATATGCGGCTCAGACCGGG + Intronic
920260543 1:204685291-204685313 GTGCAGCTTCGGGGCTGACCTGG - Intronic
920312430 1:205056528-205056550 CTGCAGCTGAGGCCCAGCCTTGG - Intronic
924436822 1:244049286-244049308 GTGCAGCTGCGGCGCGGGGCGGG + Intronic
1067228994 10:44394000-44394022 GTGCAGCTGAGGCTCTGACCAGG + Intergenic
1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG + Intronic
1070304769 10:75233839-75233861 CTGCAGTTGGGCCACAGACCTGG + Intergenic
1072741097 10:97910354-97910376 CTGCAACTGCTTCTCAGACCTGG - Intronic
1072915116 10:99533031-99533053 CGGCAGCAGCGGCGGAGTCCAGG + Exonic
1073302444 10:102479390-102479412 CTGCTGCTGTGGCCCACACCTGG + Exonic
1076324166 10:129608357-129608379 ACGCAGCTGCGGCGCAAACCCGG - Intronic
1076858416 10:133128423-133128445 GTGCAGCTGCGGCGCCACCCAGG + Exonic
1077027414 11:447129-447151 CTGCAGCTGGGGTGAAGACAGGG + Intergenic
1077129613 11:964339-964361 CTGCAGCTTCAGCTCTGACCTGG + Intronic
1077171505 11:1168358-1168380 CTGCAGCTGCGGCTCCTACAAGG - Intronic
1077352617 11:2099925-2099947 CTGGAGCTGCGGCTGAGAGCGGG - Intergenic
1077431594 11:2518409-2518431 CTGCAGTTGGGGTGCAGGCCTGG + Intronic
1078852302 11:15175904-15175926 CTGCAGCTGCTGCTCAAACGGGG + Exonic
1081713668 11:45233862-45233884 CAGCAGCTGCTGCGCGGAGCGGG - Intronic
1083246083 11:61429509-61429531 AGGCAGCTGCGGCGCAGACGCGG - Intronic
1083274173 11:61587611-61587633 CTGCAGCTGGGACTCAGCCCAGG - Intergenic
1083669389 11:64291752-64291774 CTGCGGCTGCGGCTGAGGCCCGG - Intronic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1085043743 11:73341901-73341923 CTGCAGCTGTGCCTCAGCCCTGG - Intronic
1090256428 11:125287722-125287744 CAGCAGCTGCCGAGGAGACCTGG - Intronic
1090888453 11:130900410-130900432 CTCCAGCTGCGTGGCAGACATGG - Intronic
1091236668 11:134026756-134026778 CTGCAGCTTCGGCCCTGGCCCGG - Intergenic
1091261197 11:134235582-134235604 CTGCAGCTGTGTGGCAGAGCCGG - Intronic
1102520680 12:113476062-113476084 CCGCCGCCGCCGCGCAGACCCGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103377466 12:120468646-120468668 TAGCAGCTGCGGCGCTGACCTGG - Intronic
1103948341 12:124539174-124539196 CTGCTGCTGCGGGGCTGAGCTGG - Intronic
1104940586 12:132392667-132392689 CTCCAGGGGCGGCGCAGTCCAGG - Intergenic
1105034411 12:132908467-132908489 GTCTAGCTGAGGCGCAGACCCGG + Intronic
1105041699 12:132966449-132966471 CTGCAGCAGCGGAGCACGCCTGG + Intergenic
1106250397 13:27978089-27978111 CTGTAGCTGCCGCGCGGGCCAGG - Exonic
1107412755 13:40172717-40172739 CTGCAGATGCTGTGCACACCTGG + Intergenic
1112368107 13:98772981-98773003 CTGCAGCTGAGGGGCTGGCCTGG - Intergenic
1113327496 13:109295935-109295957 CTGCAGCTGCTGGGAAGACTGGG - Intergenic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1113834594 13:113320392-113320414 CGGGAGCTGCGGCGCCCACCTGG + Exonic
1120765178 14:88322327-88322349 CTGGAGCTGCGCCGCATGCCCGG - Intronic
1121313391 14:92947053-92947075 GAGCAGCTGGGGCGCAGAGCCGG + Intronic
1125468227 15:39976397-39976419 CTGCACCTGCGGCACAGCCAGGG - Exonic
1127763622 15:62164576-62164598 CTGCGGCGGCGGCGGAGGCCCGG - Exonic
1129616193 15:77100252-77100274 CTGCAGCTGCAGCCCAGAGAGGG - Intergenic
1131367895 15:91854631-91854653 CTGCAGCCCCGGCTCAGGCCAGG - Intronic
1132392899 15:101451620-101451642 CTGCAGCTGCGGAGCGGACGGGG - Intronic
1132464301 16:70722-70744 CTGCAGCTCCTGGGCAGACCTGG - Intronic
1132508156 16:322885-322907 CTGCAGCTGCGTCCCAGCTCTGG + Intronic
1132590697 16:725140-725162 CTGCAGCTGTGGGGCACACAGGG + Exonic
1132847620 16:2007664-2007686 CTGCAGCTGCTGCTCAGGCCAGG - Intronic
1132860679 16:2070186-2070208 CTCCAGCTGCGTGGCAGACAGGG - Intronic
1133019763 16:2962262-2962284 CTGCAGATGGGGCGCAGAGGTGG - Intergenic
1133021698 16:2969712-2969734 CTGCAGGTGCGGCGGCGAGCTGG - Exonic
1133060638 16:3172228-3172250 TTGTAGCTGAGGCACAGACCTGG - Intergenic
1136143377 16:28301320-28301342 CTGCAGCTGGTGCCCAGAGCTGG - Intronic
1136269420 16:29139688-29139710 CTGCTGCTGCTGCGGACACCTGG + Intergenic
1139511450 16:67430643-67430665 CGGCAGCGGCAGCGGAGACCGGG + Intronic
1141175122 16:81713648-81713670 CAGCTGCTGCGGGGCAGAGCAGG - Intergenic
1142072897 16:88100958-88100980 CTGCTGCTGCTGCGGACACCTGG + Intronic
1142240050 16:88940931-88940953 GCGCGGCTGCGGCGCAGATCCGG + Intronic
1143517390 17:7426737-7426759 CTGCAGCCTCAGCTCAGACCTGG - Exonic
1144586307 17:16489892-16489914 CTGCAGCTGAGGCGGGTACCAGG + Intronic
1144608708 17:16689993-16690015 CTGCAGCTCCAGCGCCAACCTGG - Intergenic
1144656948 17:17042803-17042825 CGGCGGCGGCGGCGCAGGCCTGG - Exonic
1144904108 17:18625834-18625856 CTGCAGCTCCAGCGCCAACCTGG + Intergenic
1145128483 17:20320908-20320930 CTGCAGCTCCAGCGCCAACCTGG - Intergenic
1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG + Intronic
1151705324 17:75764290-75764312 CTGCAGCTGGAGCACAGACCTGG + Intronic
1151829030 17:76538760-76538782 CTGCAGCGGCTGCTCAGTCCTGG + Intronic
1152061161 17:78076326-78076348 CTGCAGCTGTGGGGTAGCCCAGG + Intronic
1152103019 17:78313987-78314009 CAGCCGCTGCGGCGCGGCCCCGG + Intergenic
1153796312 18:8625936-8625958 CTGCAGCTGCGGCCCAGACAGGG - Intronic
1158505662 18:58044359-58044381 GCGCGGCGGCGGCGCAGACCCGG - Exonic
1159424174 18:68262858-68262880 CTGCAGCAGTTGCTCAGACCTGG + Intergenic
1160717462 19:582773-582795 CTCCGGCGGCGGCGCAGACGTGG - Exonic
1161102350 19:2427397-2427419 CTGCAGGTGCGGGGCTGGCCGGG - Exonic
1162913362 19:13861861-13861883 CTGCTGCTGTGTCGCAGCCCTGG + Intergenic
1162951349 19:14073575-14073597 CAGCGGCTGCGGCGGCGACCGGG - Exonic
1163668204 19:18612878-18612900 CAGCGGCTGCGGCGGGGACCGGG - Exonic
1163830333 19:19544494-19544516 CTGCAGCTGCTCCGCGGAGCCGG - Exonic
1165078507 19:33294163-33294185 CTGCAGCTTGGGGGCAGACAGGG + Intergenic
1165463735 19:35959755-35959777 CTGGTGCTGCGACGCCGACCGGG + Intergenic
1166219655 19:41356211-41356233 CTGCATGTGGGGTGCAGACCAGG + Intronic
1167414085 19:49361425-49361447 CAGCAGCTGAGGCCGAGACCAGG + Exonic
1167539388 19:50075496-50075518 CTGCTGGTGCGGGGCAGCCCTGG + Intergenic
1167630322 19:50622362-50622384 CTGCTGGTGCGGGGCAGCCCTGG - Exonic
1168505725 19:56933160-56933182 CTGCAGAAGCCGCGCAAACCAGG - Intergenic
927444754 2:23149348-23149370 CTGCAGCTGCCACTCAGGCCAGG + Intergenic
929086127 2:38168943-38168965 CTGCTGCTGCTGCTCTGACCTGG + Intergenic
932801463 2:74745928-74745950 CTGCAGGTGCAGCCCACACCAGG - Intergenic
934746137 2:96760927-96760949 CCGGAGCTGCGGTGCGGACCGGG + Exonic
934893724 2:98093118-98093140 CTGCAGCTGCTGCTCAGAGATGG - Exonic
936378321 2:111961863-111961885 CTGCAGCCGGGGCGCAGTCGTGG + Intronic
937375893 2:121335416-121335438 CTGTAGCGGCGGCGCTGCCCGGG + Intergenic
938369432 2:130760160-130760182 CTGCAGCTGGAGCCCAGCCCAGG + Intronic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
944597201 2:201271852-201271874 GTGCAGATGCAGCCCAGACCCGG + Intronic
946164155 2:217853664-217853686 CTGCAGCTGCTGAGAAGAGCAGG - Intronic
946248370 2:218399646-218399668 CTGCGGCTGCGTGGCAGGCCCGG - Intronic
946865645 2:224039250-224039272 CTGCAGACGCCGCGCAGCCCGGG + Intronic
948805712 2:240452818-240452840 GTGCGGCTGCGGCGCTGCCCGGG + Intronic
1168854963 20:1002032-1002054 CAGGCGCTGCGGGGCAGACCGGG - Intronic
1172427212 20:34863423-34863445 CGGCCGCTGCGGCGGAGAACGGG + Exonic
1173949484 20:46978977-46978999 CAGCAGCTGTGGCCCAAACCTGG - Intronic
1174830249 20:53805680-53805702 GTGCAGCTGCTGCTCAGGCCTGG + Intergenic
1175818587 20:61896396-61896418 GTGCAGCTGCGCCCCAGGCCTGG - Intronic
1176182177 20:63755127-63755149 CCGCAGCTGCGGCTCTGCCCTGG - Intronic
1176200022 20:63855892-63855914 CTGCAGGTGCGGTGGAGACGGGG + Intergenic
1176625257 21:9087133-9087155 CTGCAGCTGCGGCTCCGATGTGG - Intergenic
1179473877 21:41631111-41631133 CAGCAGCTGCAGCCCAGCCCAGG - Intergenic
1179920833 21:44506473-44506495 CTGCAGCAGGGGCTCAGACAGGG + Intronic
1180048512 21:45320777-45320799 CTGCAGCTGCGGGGCTCAGCTGG + Intergenic
1180071971 21:45441143-45441165 CTGCTGCAGCTGCCCAGACCTGG + Intronic
1180183169 21:46126980-46127002 CTGCAGCTCCGAGGCAGGCCAGG - Intronic
1180199172 21:46214588-46214610 CAGCAGCTGCAGCACAGCCCAGG + Intronic
1180222815 21:46370190-46370212 CTGCAGCTGCCTCGCTGGCCAGG - Intronic
1180636182 22:17264745-17264767 CGGCAGCAGCTGCGCAGGCCAGG - Intergenic
1180736991 22:18024525-18024547 CTGCAGCCCCGGCGGAGTCCCGG - Exonic
1181363813 22:22358332-22358354 CGGCAGCTGCTGCTCAGGCCCGG + Intergenic
1181366622 22:22381417-22381439 CAGCAGCTGCTGCTCAGGCCTGG + Intergenic
1181370369 22:22410352-22410374 CGGCAGCTGCTGCTCAGGCCTGG + Intergenic
1181650907 22:24258639-24258661 CGGCAGCTGCGGGGGAGCCCAGG - Intergenic
1182252477 22:29012024-29012046 CAGCTGCTCCGGCCCAGACCAGG - Intronic
1184037648 22:41926288-41926310 CTGCGGCTGCAGCGCCGTCCTGG + Exonic
1185243649 22:49761142-49761164 CTGCAGCTGCTGCCCAGTCAAGG + Intergenic
950545941 3:13637938-13637960 CTGCGGGTGTGGCGCAGCCCAGG + Exonic
953627242 3:44581038-44581060 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
954013422 3:47663596-47663618 CTGCTGCTGTGGCCCAGACATGG + Intronic
954327124 3:49869741-49869763 CTGCAGGTGCGGGGCGGGCCGGG - Exonic
956622440 3:71234858-71234880 CTGCAGCTTCAGGGCAGAACAGG + Intronic
962606407 3:137036043-137036065 CAGCAGCTGAGGCGCAGGCCGGG - Intergenic
966474230 3:180325446-180325468 CAGCAGGTGCAGCGCTGACCTGG - Intergenic
968577509 4:1374752-1374774 CTGAAGCTGTGGTGCAGCCCCGG + Intronic
968900626 4:3429970-3429992 CTGCAGCTGCAGCTGGGACCCGG + Intronic
969516195 4:7649440-7649462 CTGCAGCTGCAGAGCACACCTGG - Intronic
969706945 4:8817209-8817231 CTGGAGCCTCGGGGCAGACCTGG - Intergenic
969860739 4:10033724-10033746 CTGCAGCTGCCTGGCCGACCTGG + Intronic
970394774 4:15655108-15655130 CTGCGGGCGCGGCGCAGGCCAGG + Intronic
973110378 4:46390276-46390298 CACTAGCAGCGGCGCAGACCCGG + Intronic
974348477 4:60713701-60713723 CTGCAGCTTCAGCACAGAACAGG - Intergenic
979582787 4:122379621-122379643 CTGCTGCTGCGCCTCAGGCCGGG - Intronic
981429763 4:144645787-144645809 CTGCAGCAGCCGGGCAGTCCCGG + Intergenic
985916310 5:2921445-2921467 CTGCAGCCGCTGGGCTGACCTGG - Intergenic
986168871 5:5299350-5299372 CAGCAGCTCGGGCCCAGACCAGG + Intronic
994197443 5:96935988-96936010 CTGCAGCTGCCACGAAAACCCGG + Exonic
997237539 5:132282204-132282226 CTGCAGCTGCAGCCCAGTCCAGG + Intronic
1010411826 6:75569429-75569451 CTCCAGCAACGGCGCAGAACTGG + Intergenic
1017866878 6:158451573-158451595 CTGCACCTGCGGAGCACAGCCGG - Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1023819594 7:43973173-43973195 CTCCAGCTGGGACCCAGACCTGG - Intergenic
1025262036 7:57426117-57426139 CTGAGGCTGCGCCCCAGACCTGG + Intergenic
1028220206 7:88188341-88188363 ATGCAGCTTCTGGGCAGACCTGG - Intronic
1029122996 7:98281183-98281205 CCGCAGCTGAGGTGCACACCCGG + Intronic
1029550010 7:101232617-101232639 CTGCTGCTGCGGCTCTGACGAGG - Exonic
1029744645 7:102510142-102510164 CTCCAGCTGGGACCCAGACCTGG - Intronic
1029762636 7:102609304-102609326 CTCCAGCTGGGACCCAGACCTGG - Intronic
1034129074 7:148699070-148699092 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
1034275493 7:149822067-149822089 CCGCAGCTGCGGCCCGGGCCTGG + Intergenic
1034355933 7:150450820-150450842 CTGCAGCTGCGGGACGGGCCGGG + Exonic
1035249070 7:157585218-157585240 CTGCAGCTGCTCCTCAGCCCTGG - Intronic
1035367297 7:158357536-158357558 CTGCATTTGCTGCGCAGCCCAGG + Intronic
1035609142 8:948696-948718 CTGCTGCTCCAGCGCAGCCCAGG + Intergenic
1037769189 8:21789074-21789096 CTGCAGCGGCGGCGGCGACAAGG + Intronic
1041068208 8:54102069-54102091 CTGCGGCGGCAGCGCGGACCTGG + Intergenic
1041109365 8:54470364-54470386 CTGCTGGTGCGGGGCAGGCCTGG - Intergenic
1041201645 8:55455263-55455285 CTGCGGCTGCGGCGGCGGCCCGG + Intronic
1049392432 8:142379141-142379163 CTGCTGCTGAGGCGCTGACGTGG - Intronic
1049443315 8:142618970-142618992 CTGCAGTGGTGGCACAGACCTGG + Intergenic
1049496665 8:142938870-142938892 CTGCAGCTGCAAAGCAGCCCGGG - Intergenic
1049529278 8:143146378-143146400 CTCCAGCTGCAGCTCAGCCCTGG - Intergenic
1049612117 8:143560631-143560653 CTGCAGCAGCTGCGCAGCCGCGG + Exonic
1049674208 8:143882627-143882649 CTGCTGCTGAGGCCCTGACCAGG + Intergenic
1052471307 9:28899988-28900010 CTGGAGCTGCGGGGCTGACCTGG - Intergenic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1056623723 9:88236839-88236861 CTGCAGCTGTGGTGTAAACCTGG - Intergenic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1060793207 9:126499323-126499345 CTGCAGCAGCTGGGCAGCCCGGG - Intronic
1061272255 9:129550171-129550193 CTGCGGCGGCGGCGCGGTCCGGG - Intergenic
1061378113 9:130238078-130238100 CCGCAGCAGCAGCGCAGCCCAGG - Intergenic
1062070186 9:134551232-134551254 CCGCAGCTGCGGGGCAGAGCTGG + Intergenic
1062376351 9:136263586-136263608 CTGCAGCTGAGTCCCAGCCCAGG + Intergenic
1062596407 9:137301884-137301906 CTGCGTCTGCGGCGCGGAGCAGG + Exonic
1187393824 X:18903492-18903514 CTGCATCTGCTGCCCAGACAGGG - Intronic
1192198108 X:69045885-69045907 CTGAGGCTGGGGAGCAGACCAGG + Intergenic
1198767074 X:140091278-140091300 CTGCAGCCGCGGCGCAAGCGGGG + Intergenic