ID: 944173166

View in Genome Browser
Species Human (GRCh38)
Location 2:196801158-196801180
Sequence GAGAATAAACAGCAAAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 617}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944173163_944173166 -1 Left 944173163 2:196801136-196801158 CCATCTTTATGACAATCCTGGTG 0: 1
1: 0
2: 2
3: 7
4: 147
Right 944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 617
944173161_944173166 4 Left 944173161 2:196801131-196801153 CCTAGCCATCTTTATGACAATCC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944173166 Original CRISPR GAGAATAAACAGCAAAAGGA TGG Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
902876979 1:19346515-19346537 AAGAAAAACCAGCAAAAGGTGGG + Intronic
902977311 1:20098294-20098316 GGGAAGAAACAGCAAGAGCAAGG - Intergenic
902997419 1:20237552-20237574 GTGTCTAAACTGCAAAAGGAAGG - Intergenic
903596162 1:24496601-24496623 AAGAAAGAACAGCAAAAGGTTGG + Intergenic
904596891 1:31652421-31652443 GGGACTAAACGGGAAAAGGAGGG + Exonic
905566589 1:38970254-38970276 GACAATTTAAAGCAAAAGGAAGG - Intergenic
907643295 1:56214437-56214459 GAGAAGAAACATCCAGAGGAAGG - Intergenic
908097878 1:60759313-60759335 GAGACTAGACGGCAAAAGGAAGG + Intergenic
908312661 1:62900930-62900952 GAGAAAAATCAGCAACAGGGAGG - Intergenic
908339987 1:63167488-63167510 GGGAATCAATAGGAAAAGGAGGG - Intergenic
909536699 1:76745171-76745193 GAGATTCAACAGCAGAAGAAAGG - Intergenic
911016445 1:93338139-93338161 GAGAAAAAAAAAAAAAAGGAAGG - Intergenic
911362223 1:96892028-96892050 GACAATAACAAGCAACAGGATGG - Intergenic
911950693 1:104170568-104170590 GAGAATAAACAAGACAAGGATGG + Intergenic
912539510 1:110402978-110403000 GAGAAGATACAGTAAAAGTATGG - Intronic
912911026 1:113759287-113759309 GAGAATGAACTGGAAAATGAGGG + Exonic
913214778 1:116611037-116611059 AAGAATAAAGAGCAAGTGGAAGG - Intronic
913940359 1:125098024-125098046 GAAAATAAACAGGCGAAGGAAGG - Intergenic
913966570 1:143381982-143382004 GAGAATAACCTGGAAATGGATGG - Intergenic
914060945 1:144207589-144207611 GAGAATAACCTGGAAATGGATGG - Intergenic
914202630 1:145499647-145499669 GAAAACAAAGAGCAAAATGAAGG - Intergenic
914236560 1:145817575-145817597 GAAAACAAAGAGCAAAATGAAGG - Intronic
914481753 1:148072798-148072820 GAAAACAAAGAGCAAAATGAAGG - Intergenic
916539923 1:165743188-165743210 GAGAATATACAGGAAAATGAAGG + Exonic
916571450 1:166031323-166031345 GAGAATAAACAGCAAGACTGAGG - Intergenic
916571457 1:166031394-166031416 GAGAATAAACAGCAAAACTGAGG - Intergenic
916637484 1:166688758-166688780 GTGAATGAAAAGGAAAAGGAGGG - Intergenic
916875463 1:168963991-168964013 GAGGAGAAACAGGAAAAGGAAGG - Intergenic
917722530 1:177799432-177799454 GAGAACAAACATCAAATTGATGG + Intergenic
917923689 1:179771438-179771460 GAGACAAAACAGGAAAAAGAGGG - Intronic
918027587 1:180767391-180767413 GAGAATAAACTGTTGAAGGATGG + Intronic
918601167 1:186364575-186364597 GACAACTAAAAGCAAAAGGAAGG + Intronic
918620915 1:186604605-186604627 GAGAATAAAAAGCCAAAATATGG - Intergenic
918623415 1:186631300-186631322 GAGAATCATCAGCAATAAGATGG + Intergenic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919721533 1:200842250-200842272 GAGAAGAAAAAGAAAATGGAGGG + Intronic
919941624 1:202290873-202290895 AAAAATAAAAAGCAAAAGAAGGG + Intronic
920225958 1:204439209-204439231 GAGAATAACCATAGAAAGGAAGG + Intronic
921355036 1:214277925-214277947 TAAAATAAACAGCCAAAGAATGG - Intergenic
921366909 1:214383051-214383073 TTGAATAAACAGCAAAATGCTGG + Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
921811381 1:219518271-219518293 GAGATCCAACAGCAGAAGGAAGG + Intergenic
922382595 1:225047408-225047430 GAAAAGATACAGCAAAAGTATGG - Intronic
922405536 1:225309265-225309287 GTGAATAACAAGCAAAAGGCAGG - Intronic
922438490 1:225629770-225629792 TAGAATAAAGAGCAATAGGGAGG - Intronic
922681376 1:227599959-227599981 GAGGGTAGACAGCAAAAGGATGG - Intronic
922792993 1:228320769-228320791 GATGATAAACAGCAGATGGATGG - Intronic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
924191028 1:241552787-241552809 AAGAAAAAACAGCTGAAGGAGGG - Intronic
1064208548 10:13345584-13345606 AAGAATATACAACACAAGGATGG + Intronic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1064988194 10:21231937-21231959 GTGTATAAACCGCAAAAGGGAGG - Intergenic
1065389569 10:25168718-25168740 GGAATGAAACAGCAAAAGGAGGG - Intergenic
1066525767 10:36277527-36277549 GACAACAAACATCAAAATGAAGG + Intergenic
1066779791 10:38931793-38931815 GAAAATAAAGAGGAAAAGGAAGG + Intergenic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067701788 10:48578917-48578939 AAGATTAAAAAGCAAAAGAACGG - Intronic
1067858089 10:49814968-49814990 GAGTAGAAACAGTAAAAGTATGG - Intergenic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068452388 10:57208620-57208642 GAGAAGAATGAGCAAAAGGGGGG + Intergenic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068592849 10:58867677-58867699 GAGAATAAAGAGGAAAAGAAGGG + Intergenic
1069793441 10:71038225-71038247 GAGGTTACACAGCAAAAGGGAGG - Intergenic
1069874348 10:71552524-71552546 GAAAAAAAACAGGAAAGGGAGGG + Intronic
1070311550 10:75277021-75277043 GAAAATAATCAGCAAAAGATTGG - Intergenic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070387770 10:75941403-75941425 GAGAACACTCAGCATAAGGAGGG + Intronic
1070506721 10:77119742-77119764 GATAATGAACAGTAAAAGGCAGG + Intronic
1071441594 10:85702787-85702809 GAGAAAAAAGTGGAAAAGGAAGG + Intronic
1073101252 10:101007886-101007908 GAGAATAGCCAGCAAATGGTGGG - Intronic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073337635 10:102722057-102722079 GAGAATAAACAGGATGTGGATGG - Intronic
1073755888 10:106580121-106580143 GAGAAAGAACAGCAAAGTGATGG + Intronic
1073756782 10:106589289-106589311 GAGAATAGAAAGTAAAAAGAGGG - Intronic
1073877534 10:107942536-107942558 CGGAATTGACAGCAAAAGGAAGG + Intergenic
1074323645 10:112427015-112427037 GACAATAAACAGCAAAAAAAGGG - Intronic
1074637501 10:115337569-115337591 GAACATAGACAGTAAAAGGATGG - Intronic
1074915894 10:117954564-117954586 TGGAATAAAGAGAAAAAGGAAGG - Intergenic
1075361189 10:121836091-121836113 GAGAAGAAGCAGTAAAAGAAAGG - Intronic
1076464435 10:130668838-130668860 GAGACTAATCAGGATAAGGAAGG + Intergenic
1076561362 10:131367322-131367344 GAGAATAAAAACCACAATGAGGG - Intergenic
1078119868 11:8496118-8496140 GAAAAGAAAAAGAAAAAGGAAGG + Intronic
1078364006 11:10692011-10692033 GAAAATAAACAGCAAACACATGG - Intronic
1078777007 11:14403044-14403066 GAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1078895070 11:15590791-15590813 GAGATTAAAAAGGAAGAGGAAGG - Intergenic
1079342423 11:19623460-19623482 GAGAAAAAAGAGTAAAAAGAAGG - Intronic
1079502633 11:21118793-21118815 GACATAAAACAGCAAAAGAAAGG - Intronic
1079503432 11:21128358-21128380 GAAAATAAACGCCAAAAGGGGGG - Intronic
1079779167 11:24577042-24577064 GCAAATAAATAGCAAAAGCATGG - Intronic
1080032409 11:27675837-27675859 GAGTCAAAACAGCCAAAGGAAGG + Intronic
1080113176 11:28592679-28592701 GAGAGTGAAAAGCTAAAGGAAGG - Intergenic
1080125770 11:28731851-28731873 GAAAATAAACAATAAAAGGAAGG + Intergenic
1080294368 11:30708627-30708649 GAGATAAAAAAACAAAAGGATGG + Intergenic
1080917511 11:36674668-36674690 TAGAATAAACAGCATAGAGAAGG + Intergenic
1080918173 11:36681240-36681262 GATAATAAAGAGGAAATGGAAGG - Intergenic
1081011285 11:37815673-37815695 GAGACTAAACAGAAATATGAAGG - Intergenic
1081093113 11:38897675-38897697 TAGAGTGAACAGGAAAAGGAAGG + Intergenic
1081542646 11:44047343-44047365 GAGAAGAAAAGGCAAAAAGAAGG + Intergenic
1081938327 11:46919470-46919492 GAGAGTAGACCACAAAAGGAAGG - Intergenic
1083610402 11:64001533-64001555 GAGATCAAACAGCAAAAGAAAGG - Intronic
1083704418 11:64504205-64504227 GAGAACAAAAAGGCAAAGGAAGG - Intergenic
1083705051 11:64508406-64508428 GAGAAACAACAGCCAAAGGGTGG - Intergenic
1083955428 11:65980324-65980346 GAGAATACAGAGCTCAAGGAAGG - Intergenic
1086399604 11:86449773-86449795 CAGAATAGAGAGCAAAATGAGGG - Intronic
1086722637 11:90139650-90139672 GATAATTTAAAGCAAAAGGAAGG - Intronic
1086963132 11:93000463-93000485 GAAAATAAAGAGAAAAAAGAAGG - Intergenic
1087486819 11:98767773-98767795 GAGAATAAACAGGGACAGGCTGG - Intergenic
1087803380 11:102528634-102528656 GAGATTTAACAGCAGAAAGAAGG - Intronic
1088011160 11:105002423-105002445 GAGAAGAAAAAGGAGAAGGAAGG - Intronic
1088118787 11:106343204-106343226 GAGAAACTAAAGCAAAAGGAAGG + Intergenic
1088184009 11:107143314-107143336 GAGAATGAAAAGCCAAAGGTAGG - Intergenic
1088927601 11:114318275-114318297 TTGAATAAACAGCAAATAGAAGG - Intergenic
1088964613 11:114705684-114705706 GAGGAAAAAGAGGAAAAGGAAGG + Intronic
1089673951 11:120076787-120076809 GAAAATAAAGAGAAAAAAGAAGG + Intergenic
1089728681 11:120506111-120506133 GAAGAAAAACAGTAAAAGGATGG + Intergenic
1090566248 11:127995175-127995197 GAAAATAAACAGGATAATGAAGG - Intergenic
1091155087 11:133364704-133364726 GAGAATAAAGATAAAAAGAAGGG - Intronic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091598880 12:1904860-1904882 GAAAACAAATAGCAAAATGATGG + Intronic
1091889597 12:4042878-4042900 AAGAATAAAAAGAAAAAGAAAGG + Intergenic
1092036574 12:5340770-5340792 GAGAAAAAACATCAAAAAGTGGG + Intergenic
1093787802 12:23213046-23213068 GTGAATGAACATCAAAAGAAGGG - Intergenic
1094268601 12:28586636-28586658 GAGAATAAACAGAGACAGGTAGG - Intergenic
1094641757 12:32282638-32282660 GTGAGGAAACAGCAAAAGGAGGG + Intronic
1094765721 12:33592403-33592425 GTGAATAAAAATCAAAAGGAGGG + Intergenic
1095261391 12:40103937-40103959 TACAATAAACAGCAAAAGGAAGG + Intronic
1095354011 12:41249611-41249633 GAAAATAAACTGCAATAGCAAGG - Intronic
1095932892 12:47646889-47646911 AATCATAAACAGCAAAAAGAAGG - Intergenic
1097122197 12:56742744-56742766 TAGAATTAACAGCTAAAGAATGG - Intronic
1097370691 12:58776299-58776321 GATAAGAAACAGAAAAAGGAAGG + Intronic
1097609440 12:61800640-61800662 GAGCAAAAGCAGCAAAAAGAAGG + Intronic
1098266002 12:68719970-68719992 GAGAATGAAAAACAAGAGGAAGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1099099319 12:78418282-78418304 GAGAATAACCAGCAAACTGACGG - Intergenic
1099992152 12:89735135-89735157 TAGAATAAAAAGGCAAAGGAAGG - Intergenic
1101352736 12:103947414-103947436 AAGAAGAAACAGCAAAGGTATGG + Exonic
1101485465 12:105153991-105154013 GAGAATAAAGAGTAAAACGATGG - Intronic
1102383930 12:112491105-112491127 GAGAAGAAACAGCACAAGGAAGG + Intronic
1102635964 12:114324218-114324240 AATAATAAACAGTAAAAGGTGGG - Intergenic
1103229155 12:119313604-119313626 GAGAATAAACAGCTAAGAGAAGG - Intergenic
1103493646 12:121344005-121344027 GAAGTAAAACAGCAAAAGGAAGG + Intronic
1103504122 12:121429349-121429371 GAGAAGCAAAAGCAAAAGAAAGG + Intronic
1105351962 13:19623925-19623947 TTACATAAACAGCAAAAGGAAGG - Intergenic
1105431921 13:20344527-20344549 GCCAATAAACAGCAAAAACACGG - Intergenic
1105447384 13:20469625-20469647 GAGAATAAACAGATACCGGAAGG - Intronic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1106284022 13:28303343-28303365 GAGAGTAACCAGTAAAAGTAAGG - Exonic
1106536625 13:30650187-30650209 GAAAATGAACAGAAAAGGGAAGG + Intronic
1106711973 13:32347285-32347307 GAGAAGAAACAACAAAAGTTTGG + Intronic
1106903857 13:34384273-34384295 GAAAATAAACTGCAAACTGAGGG - Intergenic
1107299586 13:38950857-38950879 GTGAAGAAACAACAAAAAGATGG + Intergenic
1107495416 13:40921584-40921606 TAAAATAAATAGCAAAGGGAAGG + Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1109042726 13:57360533-57360555 GAGAAAGAAAAGGAAAAGGAAGG + Intergenic
1109096718 13:58128212-58128234 CAGAATAAATAGCTAAAGCATGG - Intergenic
1109590887 13:64480003-64480025 TAGAAAAAACAGCAAAAAAATGG + Intergenic
1109657916 13:65419045-65419067 AACAAAAAACAGAAAAAGGAAGG - Intergenic
1109858190 13:68161214-68161236 GAGAATTAGAAGCAAAAAGAGGG - Intergenic
1110250381 13:73374632-73374654 AAGAAGAAACAGCAAAAAGTAGG - Intergenic
1110495968 13:76168303-76168325 GAGAACAGAGAGCAAAAGCAAGG + Intergenic
1110884182 13:80612501-80612523 CAGACTAAACACCAAATGGATGG - Intergenic
1111320059 13:86615252-86615274 GAGAGTAAACAACAACAGAATGG - Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111373797 13:87352485-87352507 CAGAATAAACAGCCAAAGGATGG - Intergenic
1111427174 13:88101933-88101955 GAGAAAACAGAGTAAAAGGAAGG + Intergenic
1111480895 13:88824930-88824952 GAGAAAAAGAAGGAAAAGGAAGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111956139 13:94760664-94760686 GAAAATAACCAGCATAAAGAGGG - Intergenic
1112376464 13:98846465-98846487 GAGAACAAACATGCAAAGGAAGG + Intronic
1112421845 13:99259340-99259362 GAGAAAAAAAAAAAAAAGGATGG - Intronic
1113028833 13:105971439-105971461 AAGAATAAACAGGAAATGCAAGG - Intergenic
1113057925 13:106289557-106289579 GAGAATCAGAAGCAATAGGATGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115107069 14:29774402-29774424 GAGAAAGAAGAGGAAAAGGAAGG + Intronic
1116520240 14:45837530-45837552 GACAATTTAAAGCAAAAGGAAGG - Intergenic
1116722531 14:48518060-48518082 GGGAATAAATACCAAAAGGAAGG + Intergenic
1117261516 14:54039121-54039143 GAGATTCTACAGCAAAAAGATGG + Intergenic
1117308694 14:54501042-54501064 GAGAAAAAATAGGAAAAGGGAGG + Intergenic
1117521107 14:56552212-56552234 GAGAAAAAATAGCATCAGGAAGG + Intronic
1117986487 14:61390993-61391015 GAGAATAAAATTCAAGAGGAAGG + Intronic
1118107172 14:62673027-62673049 GAGCATAAAAAGCAAGAGGCTGG + Intergenic
1118248787 14:64138072-64138094 AAGAAAAAACAGCATAAGGTGGG - Intronic
1118896302 14:69948670-69948692 GAGAACACACAGAAAAAAGAGGG - Intronic
1120127837 14:80767558-80767580 AAGAATATACAGGAAAAGGAAGG + Intronic
1120479953 14:85037307-85037329 GAGAATAAAAAGCAGAGGAAAGG - Intergenic
1120768636 14:88355212-88355234 GAGAATAGGCAGCAAAAAGGGGG - Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121990630 14:98553432-98553454 GAGAATAAAAAGAAAAAGTGGGG - Intergenic
1122679093 14:103443024-103443046 GAGAAAACACAGAAAAATGAGGG + Intronic
1202937470 14_KI270725v1_random:104447-104469 GAAAATAAAGAGGAAAAGGAAGG - Intergenic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124817546 15:33010624-33010646 GATTATAAAGAGAAAAAGGAAGG + Intronic
1124822774 15:33063837-33063859 AAGAATGAACAGCATAAGGGTGG - Intronic
1125685472 15:41560861-41560883 GAGCCCAGACAGCAAAAGGAAGG - Intronic
1126294233 15:47119396-47119418 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1127040133 15:54966140-54966162 GTGAAAACACAGCAAAAAGATGG - Intergenic
1127149832 15:56061992-56062014 GAGAAGAAAGAGAAAAAGAATGG + Intergenic
1127330195 15:57931566-57931588 GAGGAAAATGAGCAAAAGGAAGG - Intergenic
1127400647 15:58582127-58582149 GAGAAGGAAGAGGAAAAGGAAGG + Intergenic
1127596781 15:60491788-60491810 AAAAATAAATAGCAATAGGAAGG + Intronic
1128095721 15:64953435-64953457 GAGAAGAAAGAAGAAAAGGAAGG - Intronic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1130043107 15:80421626-80421648 GAGAAAATACAGCAATAAGATGG - Intronic
1131340005 15:91590204-91590226 AAGAAGAAAGAGGAAAAGGAAGG + Intergenic
1133095438 16:3442069-3442091 GAGAGGAAATAGCAAAGGGAAGG - Intronic
1133525018 16:6596485-6596507 AAAAATTAACTGCAAAAGGAGGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134862626 16:17574266-17574288 GAGAATTAAAAGGAAAGGGATGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135172015 16:20193060-20193082 GTGAATGAACAAGAAAAGGAAGG + Intergenic
1135910609 16:26557520-26557542 GAGGAAAAAAAGGAAAAGGAAGG - Intergenic
1135980242 16:27141618-27141640 GAAAACAAAAAGGAAAAGGAAGG + Intergenic
1136769406 16:32822266-32822288 GAAAATAAACAGGCAAAGGAAGG - Intergenic
1136901076 16:34038655-34038677 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1136935626 16:34461201-34461223 GAAAATAAAGAGGCAAAGGAAGG - Intergenic
1136948918 16:34691307-34691329 GAAAATAAAGAGGCAAAGGAAGG + Intergenic
1136964192 16:34887369-34887391 GAAAATAAAGAGGCAAAGGAAGG + Intergenic
1136968338 16:34942061-34942083 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1137642704 16:50046726-50046748 TAAAATACAAAGCAAAAGGAAGG + Intergenic
1137708546 16:50550944-50550966 GAAAAGAAAAAGAAAAAGGAGGG - Intronic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1139054740 16:63168832-63168854 AAGAAGACACAGCAAAAGGATGG + Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1140022530 16:71252125-71252147 AAGAATAAATAGCAAGAGGCAGG + Intergenic
1141046998 16:80724209-80724231 GAGAAGAAAGAGGAAGAGGAGGG + Intronic
1141050111 16:80753979-80754001 GAGAATGAGCTGCAAAATGATGG + Intronic
1141084431 16:81081676-81081698 GTGAATAAACAGCAAAAATAAGG - Intergenic
1141537302 16:84691239-84691261 GAGAAAAAACTGCTAAAGAAAGG - Intergenic
1203071822 16_KI270728v1_random:1084371-1084393 GAAAATAAACAGGCAAAGGAAGG - Intergenic
1142735077 17:1892314-1892336 AATATTAAACAGCAAAAAGAGGG - Intronic
1142768332 17:2078710-2078732 GAGACTAAGGAGTAAAAGGAAGG + Intronic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1144870571 17:18367627-18367649 GAAAAGAAAAAGAAAAAGGAAGG - Intergenic
1145709100 17:26952484-26952506 GAAAATAAAGAGGAAAAGGAAGG + Intergenic
1146015003 17:29226147-29226169 AAGAAACAACAGCAAAAGGCAGG + Intergenic
1147873485 17:43604219-43604241 GAGTATATACAGAGAAAGGATGG + Intergenic
1148291341 17:46453012-46453034 GAGACCAAACAGGCAAAGGAGGG - Intergenic
1148313528 17:46670715-46670737 GAGACCAAACAGGCAAAGGAGGG - Intronic
1148767805 17:50049423-50049445 GTGGAGAAACAGCAAAAGGCTGG + Intergenic
1148882977 17:50745787-50745809 GAGAAGAAAGAGAAAAAGAACGG + Exonic
1150023354 17:61644193-61644215 GAGAGGAAAAAGGAAAAGGAAGG - Intergenic
1150354165 17:64469114-64469136 GAAAAGAAAAAGGAAAAGGAAGG + Intergenic
1150506647 17:65705568-65705590 GAGAACAAAAAGAAAAAGGAAGG + Intronic
1150702082 17:67456476-67456498 GAGAAAAAACAGAAAAAGTATGG - Intronic
1151228233 17:72662444-72662466 AAGAAAAAAAAGAAAAAGGAAGG + Intronic
1151441233 17:74130527-74130549 GAGAGTCGGCAGCAAAAGGAGGG + Intergenic
1151886984 17:76928722-76928744 GAGAAAAAAGAAAAAAAGGAAGG + Intronic
1152840853 17:82567134-82567156 GAGAAACAACTCCAAAAGGAGGG - Intronic
1153052876 18:916727-916749 GAGAAGTAACAGGAAAAGGCAGG + Intergenic
1153506594 18:5805905-5805927 GAAAACAAACAGGAAAATGATGG - Intergenic
1154200864 18:12299721-12299743 GAGAATCTAAAGCAAAAGGCAGG - Intergenic
1154247506 18:12712273-12712295 CAGAAAAAACAGTAAAAGGTAGG - Intronic
1154519150 18:15208278-15208300 GAAAATAAAGAGGAAAAGGAAGG - Intergenic
1155240472 18:23859555-23859577 TATAATAAACAGCAATAGGAAGG - Intronic
1155594515 18:27469759-27469781 CAGCAAAAACAGCAAAAGCAGGG - Intergenic
1155692009 18:28636015-28636037 GTGTCTAAACAGCAAAAGGGAGG + Intergenic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1156272969 18:35554281-35554303 TGGAATAAAGAGCAAAAGTATGG - Intergenic
1156936912 18:42720446-42720468 GTGAAGAGACAACAAAAGGATGG - Intergenic
1156996717 18:43477917-43477939 GAGAATAAACAAGAGAAGAAAGG - Intergenic
1157031273 18:43911361-43911383 AAGATTAAGCAGCAAAAGAAAGG + Intergenic
1157075524 18:44462685-44462707 GAGAAAAAACTGCATCAGGAGGG - Intergenic
1157079173 18:44503523-44503545 GATCAGAAAAAGCAAAAGGAAGG + Intergenic
1157380007 18:47205526-47205548 GACAATAAAAAACCAAAGGAGGG - Intergenic
1157731768 18:50010299-50010321 GGGAATAGCCAGCAAGAGGAAGG - Intronic
1158091913 18:53724842-53724864 TAGAAAATACAGCAAAATGAAGG - Intergenic
1158170668 18:54595821-54595843 AAGACTAAGCAGCGAAAGGAAGG - Intronic
1159117299 18:64129507-64129529 GAGGAATAACAGCAAAAGTATGG - Intergenic
1159833220 18:73303948-73303970 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1160291366 18:77597470-77597492 GAGAAAGAACAACAAAAGGGAGG + Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161385626 19:3990891-3990913 GAGAAGGAACAAAAAAAGGAAGG - Intergenic
1161394488 19:4037956-4037978 GACAATAAAAAGAAAAAGAAAGG - Exonic
1162083672 19:8235408-8235430 GGGAAAAAAAAGCAAAAAGATGG - Intronic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1163226729 19:15967199-15967221 GAAAATAAAGAAAAAAAGGAAGG + Intergenic
1164612108 19:29639524-29639546 AAGAATAAACAGCCAGATGAAGG + Intergenic
1164699713 19:30276061-30276083 GCCAATAAACTTCAAAAGGATGG + Intronic
1165552302 19:36597739-36597761 AATACTACACAGCAAAAGGAAGG + Intronic
1165757018 19:38299533-38299555 GGGAATAAACAGGAAAGGGCAGG + Intronic
1167770957 19:51517659-51517681 GAGATTAAAGAAAAAAAGGATGG - Intergenic
1202700353 1_KI270712v1_random:159477-159499 GAGAATAACCTGGAAATGGATGG - Intergenic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925581329 2:5414314-5414336 GAGATTACACAGCAAAAATAAGG - Intergenic
925860824 2:8173434-8173456 CAGCACAAACAGCAAAGGGAAGG + Intergenic
927356425 2:22178435-22178457 GAAAATAAACAGGACAAAGAAGG + Intergenic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
928256357 2:29726314-29726336 TAGAATAATAATCAAAAGGAAGG + Intronic
928653862 2:33428857-33428879 GAGTATAAACATCAAAATCAGGG - Intergenic
929256749 2:39819316-39819338 GAGCATACAGATCAAAAGGATGG + Intergenic
930335529 2:50040407-50040429 GAGAGAAAAAAGCAAAAGAAAGG + Intronic
931012482 2:57933203-57933225 GAAAATAAACAACAAAATGTTGG - Intronic
931186768 2:59960040-59960062 GAGAATAATCACCAAATGCAAGG - Intergenic
931261626 2:60624928-60624950 GACAATTAACAGTAAAGGGATGG + Intergenic
931585705 2:63824555-63824577 AAAAAAAAACAGGAAAAGGAAGG + Intronic
931776395 2:65544709-65544731 GAGAATAAGACCCAAAAGGAAGG - Intergenic
931956384 2:67430562-67430584 GAGTATAATTAGCAAAATGAAGG + Intergenic
933375016 2:81467785-81467807 GAAAATAGAAAGTAAAAGGATGG - Intergenic
934171282 2:89542953-89542975 GAGAATAACCTGGAAATGGATGG - Intergenic
934249421 2:90336400-90336422 GAAAATAAAGAGGCAAAGGAAGG - Intergenic
934260158 2:91467066-91467088 GAAAATAAAGAGGCAAAGGAAGG + Intergenic
934281590 2:91617271-91617293 GAGAATAACCTGGAAATGGATGG - Intergenic
934329791 2:92053764-92053786 GAAAATAAAGAGGCAAAGGAAGG - Intergenic
935496250 2:103785040-103785062 GAAAGCAAACAGCAAAAGGATGG + Intergenic
935854059 2:107256049-107256071 GAAAATAAGCAGCAAAAAGGAGG - Intergenic
936980468 2:118260314-118260336 GGGAACAAACAGGAATAGGAGGG + Intergenic
937032899 2:118755477-118755499 GAGAACAATCAGCAGAAGCAAGG + Intergenic
937175712 2:119932151-119932173 CAGAAGAAACAAGAAAAGGAAGG - Intronic
937240435 2:120457628-120457650 GAAAAAAAAGAGCAAGAGGATGG + Intergenic
937495725 2:122417093-122417115 GAGGATAAAAAGCGAAACGAAGG - Intergenic
937536856 2:122899539-122899561 GATAATAAACAGCAAAATGGTGG - Intergenic
938519150 2:132048838-132048860 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
938776935 2:134550279-134550301 GATAAGAAAAAGCAACAGGATGG + Intronic
939528994 2:143333787-143333809 TAGAAGAAACAGGAAAAAGATGG + Intronic
940588067 2:155682087-155682109 CAGAATTAAAAGGAAAAGGAAGG + Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941451702 2:165667755-165667777 GAGAATAGACATGAAAAGGAAGG - Intronic
941581153 2:167296800-167296822 GAATATAAACTGCAAAAGGGTGG - Intergenic
941831701 2:169968378-169968400 GAAAGTAGACAGCAAAATGATGG - Intronic
943376684 2:187086290-187086312 GAGTATAAATAGCATGAGGAAGG + Intergenic
943540480 2:189207845-189207867 GAGAAAAAAATTCAAAAGGATGG - Intergenic
943575884 2:189630625-189630647 CAGAATGAACAGAAAAAGGTTGG + Intergenic
944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG + Intergenic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
944627536 2:201587421-201587443 GAGAATATACTTCAAAAAGATGG - Intronic
944688306 2:202137069-202137091 GAGAAACAACAGAAAAGGGAAGG + Intronic
945288374 2:208104923-208104945 TACAATAAAAAGAAAAAGGAAGG - Intergenic
945573492 2:211501204-211501226 TAAAATAAACAGCATAAGAAGGG + Intronic
945809215 2:214527719-214527741 GACAATAAACAGGGAGAGGAGGG - Intronic
946631926 2:221678634-221678656 GAGAAGAATTAGCAAAAGCAGGG - Intergenic
947977002 2:234375516-234375538 GAGAATAAAAAATAAAATGATGG - Intergenic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1168857924 20:1022211-1022233 GACAGGAAACAGCAAAAGGCAGG + Intergenic
1169679550 20:8195437-8195459 GTGAAGACACAGCAAAAAGATGG + Intronic
1169828022 20:9790988-9791010 GAGCAGAAACAGGAGAAGGAAGG - Intronic
1170149210 20:13211245-13211267 GAAAATAAACAGCAAAAATTAGG - Intergenic
1171143920 20:22765479-22765501 AAGAAAGAACAGCAAAAGAAAGG + Intergenic
1171161897 20:22933557-22933579 GATAAGAAACAGGACAAGGATGG - Intergenic
1173168739 20:40705146-40705168 TAGAAGAAAAAACAAAAGGATGG + Intergenic
1173834152 20:46114114-46114136 GAGAATAAAGGTCTAAAGGATGG + Intergenic
1174551336 20:51364122-51364144 AGGAAGAAACAGTAAAAGGAAGG + Intergenic
1174620216 20:51868388-51868410 GAAAAAAAAGAGCAAAGGGAAGG - Intergenic
1174848096 20:53963484-53963506 GAAAAAAAAAAGAAAAAGGAGGG + Intronic
1175632706 20:60555863-60555885 GAGAACAATCATCAACAGGAAGG + Intergenic
1176095022 20:63337149-63337171 GGAAAGAAACAGCAAGAGGAGGG + Intergenic
1176742564 21:10617389-10617411 GAAAATAAAGAGGAGAAGGAAGG + Intergenic
1176997169 21:15569028-15569050 GAAATTAAAAAGGAAAAGGAAGG - Intergenic
1177340056 21:19786615-19786637 AAGAATCACGAGCAAAAGGAAGG + Intergenic
1177591895 21:23181963-23181985 GAAAATAAACAGAAAAATGCAGG + Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1177938474 21:27379739-27379761 GGGAAACAACAGCAAAAAGAAGG + Intergenic
1178248186 21:30974404-30974426 TACAAAAAACAACAAAAGGAGGG + Intergenic
1178400446 21:32280494-32280516 GAAAAAAAAAAGCAGAAGGAAGG - Intergenic
1179391885 21:41001373-41001395 GAGAATGAACAACAACAAGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179676883 21:42989078-42989100 GACATCAAACAGAAAAAGGAAGG - Intronic
1179833678 21:44013685-44013707 GACAAAATAAAGCAAAAGGAAGG - Intronic
1180525441 22:16254830-16254852 GAAAATAAAGAGGAAAAGGAAGG + Intergenic
1180657368 22:17434180-17434202 GAGAATGAACAGTTAAAGCATGG + Intronic
1182707352 22:32293688-32293710 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1182801814 22:33037904-33037926 GAGAAGAAAGAGAAAAAGAAAGG + Intronic
1183791632 22:40075677-40075699 AAGAATAAACAGAAAACAGATGG - Intronic
1184395693 22:44237077-44237099 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1203237720 22_KI270732v1_random:21962-21984 GAAAATAAAGAGGAGAAGGAGGG + Intergenic
949688771 3:6609811-6609833 TAGAATAAAGAGGAAATGGATGG + Intergenic
949946397 3:9193286-9193308 GAGAAAAAAGAGCAATCGGATGG - Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950302731 3:11895446-11895468 TAGAATAAACAGCATAGAGAAGG + Intergenic
950944879 3:16934648-16934670 GAGAGTAAACCGGAAAGGGATGG + Intronic
951486343 3:23215708-23215730 AGGAATAAACAGCAAAGAGAAGG - Intronic
951553702 3:23899862-23899884 GATAATAAAAAGCCCAAGGAGGG + Intronic
952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG + Intergenic
952224017 3:31355666-31355688 GAGAATAATCAACAAAGTGAAGG + Intergenic
953368395 3:42366604-42366626 GAGAAGAGACAGAGAAAGGAGGG - Intergenic
954100817 3:48371297-48371319 GAGAAGAAACAGTAAAATAAAGG - Intergenic
954987564 3:54809263-54809285 GAGAAGAAAGAGATAAAGGAAGG - Intronic
955205526 3:56892478-56892500 GTGAATAAACATATAAAGGAGGG - Intronic
955553706 3:60112539-60112561 CAGCAGAAACAGCCAAAGGAGGG + Intronic
956082027 3:65567534-65567556 AAGAAGAAAGAGGAAAAGGATGG + Intronic
956186677 3:66569427-66569449 GAGAATAACCAGCAAGGGGAAGG - Intergenic
956282537 3:67572949-67572971 ATGAATAAACAAGAAAAGGAAGG + Intronic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
957375190 3:79347152-79347174 GATAATACAAAGCAAATGGAGGG + Intronic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957800567 3:85074450-85074472 GAAAATAAACAACATAAGGGAGG - Intronic
957987613 3:87591347-87591369 GAGAAGAATGAGCAAAAGGGGGG + Intergenic
958150754 3:89691119-89691141 CAGCAGAAACAGCAAAAGAATGG - Intergenic
958152392 3:89706985-89707007 GAGATTAAACAAGAAAAGAAGGG + Intergenic
959321451 3:104880441-104880463 GAAAATAACTAGCAAAAAGATGG - Intergenic
959384419 3:105684508-105684530 GAGAATAAGCCACAAAAGTAAGG + Intronic
959600963 3:108185256-108185278 GACAATTTAAAGCAAAAGGAGGG + Intronic
959855685 3:111154914-111154936 GAGAATGACAAGCAAAAGAATGG - Intronic
961203676 3:125063853-125063875 GAGAAGAAACAGAAGAGGGAAGG - Intergenic
961259603 3:125590617-125590639 CAAAATAATCAGGAAAAGGAAGG - Intronic
962628451 3:137250812-137250834 GAGAAAAAAGAATAAAAGGATGG + Intergenic
962838904 3:139215660-139215682 GGGAAGAGACAGGAAAAGGAAGG - Intronic
963592834 3:147285427-147285449 GAGAAGAAAGAGGAAGAGGAGGG - Intergenic
964212449 3:154243525-154243547 AAGATTAAAAGGCAAAAGGATGG - Intronic
964746799 3:160020195-160020217 GAGAAGAAAGAGAGAAAGGAAGG + Intronic
964779496 3:160319946-160319968 GAGAAAAAACAAGAAAAAGATGG + Intronic
964811673 3:160671134-160671156 GGGAATAGACAGCAAAAGTGAGG - Intergenic
965078702 3:164010261-164010283 GAGAACACACAGAAAAAGGCAGG + Intergenic
965669721 3:171134656-171134678 AAGAATACTCAGTAAAAGGAGGG + Intronic
966047092 3:175565490-175565512 GAGAATAAAGAGTCAAAAGATGG - Intronic
966323900 3:178732966-178732988 GGGGATAAACAGCAAAAGACAGG + Intronic
966497318 3:180595872-180595894 TAGAATAAAAGGCAAAAGTAGGG - Intergenic
967458313 3:189715893-189715915 GAGAATAATGAGCTAAGGGATGG - Intronic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967965813 3:194959525-194959547 GAGAATGACCAGCAAAGGCAAGG + Intergenic
968212772 3:196862625-196862647 GAGAATGAAAAGCAATAGGAAGG - Intergenic
969028485 4:4192935-4192957 GAGAATAACCTGGAAATGGATGG + Intronic
969270794 4:6099238-6099260 GAGAAGAGACAGCAAAACGGTGG - Intronic
969990437 4:11256708-11256730 GAAAATAAGCACCAAAATGAGGG + Intergenic
970876662 4:20878533-20878555 GAGAATAAACAAGAAAACAAAGG - Intronic
971647365 4:29226010-29226032 GAAAATAAAGAACAAAAGGAAGG - Intergenic
972132082 4:35850374-35850396 GAGAAGGAAAAGCAGAAGGAAGG - Intergenic
972328482 4:38041040-38041062 GAGAATATGCATCAAAAGAATGG - Intronic
972927041 4:44022426-44022448 GAGAAAAAAGAGGAAAGGGAAGG + Intergenic
973054314 4:45635617-45635639 GAGAATAGAGAGTAAAAGGATGG + Intergenic
973066090 4:45795204-45795226 AAGAAAGAAGAGCAAAAGGAAGG - Intergenic
974178150 4:58351160-58351182 GAAAATTAACAGCAGAAAGAAGG - Intergenic
974242567 4:59269153-59269175 GACAATTTAAAGCAAAAGGAAGG - Intergenic
974554097 4:63420850-63420872 AAGAAGAAATAACAAAAGGAAGG - Intergenic
974972427 4:68846257-68846279 GAGAAGAATCAGCAATAGCAGGG + Intergenic
975667418 4:76746347-76746369 GAGAAGATACAGTAAAAGTATGG - Intronic
975788574 4:77922289-77922311 CAGAAGAAACAGCAAATGCAAGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977257273 4:94755069-94755091 GAGAATAAACATCCTAAGCAAGG - Intergenic
977278595 4:95010473-95010495 GACACTGAACACCAAAAGGAGGG - Intronic
977339193 4:95735971-95735993 GACAATGTAAAGCAAAAGGAAGG - Intergenic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
978469906 4:109053891-109053913 GTGGATAAAAAGCAAAGGGATGG + Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979098396 4:116581402-116581424 GAGTAGAAAGAGAAAAAGGAAGG - Intergenic
979237210 4:118414854-118414876 AAGAATAAACACTAAAAAGATGG - Intergenic
979286326 4:118929078-118929100 GAAAAAAAAAAGAAAAAGGAAGG + Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979873200 4:125851995-125852017 TATAAAAAACAGAAAAAGGACGG - Intergenic
980293223 4:130871487-130871509 GAGAAAAGTGAGCAAAAGGAGGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980627625 4:135393858-135393880 GAGAAGACACAGCAAGATGATGG - Intergenic
980794869 4:137668522-137668544 TAGAAAACACAGCAAAAGAAAGG - Intergenic
981058445 4:140392236-140392258 GAGGAAAAAAAGCAAAATGATGG - Exonic
981735213 4:147942608-147942630 GAGAATAAAGAGGATAAGGAGGG - Intronic
981865387 4:149411588-149411610 GAGAAGAAAAAGCAAAGGAAAGG + Intergenic
982039985 4:151387777-151387799 CAAAATAAAGAACAAAAGGAAGG + Intergenic
982592854 4:157337029-157337051 GAGAATATGCAGCAAAAACACGG - Intronic
982885542 4:160775889-160775911 AAGAATGAAAAGCAAAATGAAGG + Intergenic
983112580 4:163771502-163771524 GTGAAGATACAGCAAAAAGATGG - Intronic
983561527 4:169106612-169106634 GAGAAAATAAAGGAAAAGGAAGG + Intronic
983960904 4:173752770-173752792 GAGACTGAACGGCAGAAGGAGGG - Intergenic
984256750 4:177398663-177398685 GAGAAGAAATAGGAAATGGAAGG - Intergenic
984744716 4:183203289-183203311 AAAACTAAACAGGAAAAGGAGGG - Intronic
985192346 4:187389571-187389593 AAGAGTAACCAGCAGAAGGAGGG + Intergenic
985237685 4:187894096-187894118 AAGAAAAAAAAGAAAAAGGATGG + Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
987041252 5:14064906-14064928 GAGAAGAGACAGGGAAAGGAAGG - Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987069784 5:14325439-14325461 GAGAAGCAAGAGAAAAAGGAGGG + Intronic
987267057 5:16266825-16266847 GAGAAGAAACAGCAAAAGTAAGG - Intergenic
987380385 5:17279694-17279716 CAGAATAGAAATCAAAAGGATGG - Intergenic
988015356 5:25550438-25550460 GACAATAAATAGAAAAATGAAGG - Intergenic
988106050 5:26749915-26749937 GAGGATAAACAGGAAAATGAAGG - Intergenic
988421945 5:31016561-31016583 GAGAATACACAGAAAACAGAAGG + Intergenic
988653427 5:33179697-33179719 GAGAAGAAACACCAAAAGCTTGG - Intergenic
988697959 5:33643050-33643072 GAGAAAAAAAGTCAAAAGGAAGG + Intronic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
989657331 5:43759065-43759087 GAGAAAAAAGAACAAAAGGCCGG - Intergenic
990442501 5:55860924-55860946 GTGAAGAGGCAGCAAAAGGAAGG - Intronic
990599374 5:57342081-57342103 AAGAAAAAACAGTAAAAAGAGGG - Intergenic
991191813 5:63883280-63883302 GGGAATAAAGAGCCCAAGGAGGG + Intergenic
991991065 5:72339873-72339895 GAGAAAAACAAGCAAAAAGAGGG - Intronic
992353076 5:75951012-75951034 TAGAATAAAGAGAGAAAGGATGG - Intergenic
992381259 5:76240025-76240047 CAGAATAAAAAGCATAAGAAAGG - Intronic
992440039 5:76789820-76789842 GGGAAGAAAGAGCAAAAGAAAGG - Intergenic
992582282 5:78192242-78192264 GAGAAAAAAAAGCAAAAATAGGG + Intronic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
992871390 5:81008915-81008937 GACAATCAACCACAAAAGGATGG - Intronic
992932626 5:81665275-81665297 GAGAATAAATAATAAAATGAAGG + Intronic
993880860 5:93359427-93359449 CAACATAAACAGGAAAAGGAAGG - Intergenic
994397799 5:99240504-99240526 GAGAATAAAGAGAACATGGATGG + Intergenic
994770522 5:103975328-103975350 GAGAATGAAGAGACAAAGGAAGG + Intergenic
995119742 5:108523029-108523051 GACAACAAATAGCAAAAGTAAGG - Intergenic
995274311 5:110260921-110260943 GAGATGAAAAAGCAAAAGCAAGG - Intergenic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
995767257 5:115632489-115632511 GAGAAAGAAAAGAAAAAGGAAGG + Intronic
995882721 5:116860872-116860894 GATAATAAACTGGAAAAGGAAGG - Intergenic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996075053 5:119182912-119182934 CAGAATAAAAAGCAAAAGTATGG - Intronic
996542201 5:124642202-124642224 GAGACTAAACAAAAATAGGATGG - Intronic
996601717 5:125272024-125272046 GAGACCAAACAGCAAAAAAAGGG - Intergenic
996876154 5:128242870-128242892 GAAAATCAACAGGAAAAAGAAGG + Intergenic
996952583 5:129145674-129145696 GATAAAAAACAGTAAAATGATGG - Intergenic
997189171 5:131914502-131914524 GAAAAGAAAAAGAAAAAGGAAGG + Intronic
997224882 5:132202344-132202366 CAGAAAAAACAACAAAAAGAAGG + Intronic
998245118 5:140494186-140494208 GACAATCAACAAGAAAAGGAAGG - Intronic
998718000 5:144907856-144907878 GAAAATAAAAAGGAAAAGCAGGG + Intergenic
998837652 5:146218588-146218610 GTGATTAATGAGCAAAAGGAAGG - Intronic
998960375 5:147480134-147480156 GAGAATAAAAGGCGAAAGAAAGG + Intronic
999936985 5:156497710-156497732 GAGAGTAAAAAGGAAAAGAAAGG + Intronic
1000706258 5:164516130-164516152 GAGACAAAAAAGCAAAAGGTGGG + Intergenic
1001828978 5:174769196-174769218 GGAAATAAAGAGAAAAAGGAAGG + Intergenic
1003049614 6:2767307-2767329 GAGAAGAACCAGCATCAGGAAGG + Intronic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1004096819 6:12563798-12563820 GAGATTAAACAAGAAAAGAAAGG + Intergenic
1005333847 6:24774173-24774195 AAAAATAAAAAGCAGAAGGAAGG - Intergenic
1006092262 6:31635030-31635052 GAGAAAAAGCAGAAAAAGGTAGG - Intronic
1007698904 6:43753471-43753493 GAGAGAAAATAACAAAAGGATGG - Intergenic
1007969211 6:46033661-46033683 GAGAAGAAACACCAAAGGGTGGG + Intronic
1008209684 6:48705155-48705177 GAAAAGAAACAGCAGAAGGGAGG + Intergenic
1008446110 6:51593708-51593730 GATGCTAAACAGCAAAAAGAGGG - Intergenic
1008521426 6:52364937-52364959 GAGCATAAACACCAAAATGAAGG - Intronic
1008683059 6:53894791-53894813 TAGAAGAAACAACAAAGGGAAGG - Intronic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009652544 6:66494342-66494364 AAAAATAAACATCAAAAAGAGGG + Intergenic
1010246242 6:73662296-73662318 GGGAATAAAAAGTAAATGGAGGG + Intergenic
1010910953 6:81555526-81555548 GTCAATAAACAACAAATGGAAGG + Intronic
1011173399 6:84531688-84531710 TTGATTAAAGAGCAAAAGGAAGG + Intergenic
1012032659 6:94092413-94092435 GACAATTTAAAGCAAAAGGAAGG + Intergenic
1012093782 6:94932447-94932469 GAGAATAAAGAAGAAAAGGGTGG - Intergenic
1012257796 6:97054311-97054333 GAGAATAAAATGTAAATGGATGG - Intronic
1012805479 6:103887366-103887388 GAGATTAAACACCTGAAGGAAGG + Intergenic
1012806447 6:103899746-103899768 GAGAACACAAAGCAAAAGAAAGG - Intergenic
1013013197 6:106138094-106138116 GGAAATAAACAGCAACATGATGG - Intergenic
1013199707 6:107881507-107881529 TAGAATAAAAAGCACAAGGAGGG - Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013842388 6:114413053-114413075 GTGATTAAAAAGCAAAAGGATGG + Intergenic
1014041736 6:116835112-116835134 GAGAAGAAGGAGGAAAAGGAGGG - Intergenic
1014203386 6:118628496-118628518 GAAAATAAAGAGAAAAAGGCTGG + Intronic
1014243468 6:119042260-119042282 GAGAAGAAAAAGGAAAAAGAAGG - Intronic
1014368773 6:120579199-120579221 GATAGAAAAGAGCAAAAGGATGG + Intergenic
1014411838 6:121134334-121134356 GAGAATGGAGAGCAAGAGGAGGG - Intronic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1015498203 6:133902759-133902781 GAGAAGAAAAAGCAAAAGACAGG - Intergenic
1016739213 6:147509777-147509799 GAAAAGAAAGAGAAAAAGGAAGG - Intronic
1016946992 6:149544730-149544752 TAGAAGAAACAGCAAAAGAATGG + Intronic
1017269066 6:152484979-152485001 GAGGAAAAACAGCAACAGTATGG + Intronic
1017385729 6:153880633-153880655 TAGAAAAATCAGGAAAAGGAAGG + Intergenic
1017593703 6:156005742-156005764 GAGAATAAACATAAAAAAGGAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018505502 6:164463483-164463505 CAGACTATACAGCAAAAGAAGGG - Intergenic
1019392982 7:799984-800006 AAAAAAAAACAGAAAAAGGAAGG + Intergenic
1020042038 7:5011599-5011621 GAGTAAAAAAAGAAAAAGGAAGG + Intronic
1020507766 7:9016078-9016100 GACAATAAATAGCACAAGGGAGG - Intergenic
1020601958 7:10286742-10286764 GAGAAAAAACAGCATGGGGAAGG + Intergenic
1021392734 7:20114210-20114232 GAGAAGAAAGGGCAAAGGGATGG + Intergenic
1021521664 7:21544355-21544377 GAGAAGAAAGAGTAATAGGAAGG + Intronic
1022035843 7:26534005-26534027 GAGAATAAACTTGAAATGGAAGG - Exonic
1022467617 7:30662144-30662166 GAGAATGAACAGTAAGTGGATGG - Exonic
1022731282 7:33028703-33028725 TAGAAAAATCAGAAAAAGGATGG + Intronic
1023067638 7:36394269-36394291 GTGTTTAAACAGCAAAAGGAGGG + Intronic
1023126160 7:36956270-36956292 CAGAATAAATAACATAAGGAAGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023528120 7:41126486-41126508 GAGAAAAACCAGCATATGGATGG + Intergenic
1024192720 7:47029162-47029184 GAGAAGAAAGGGGAAAAGGATGG + Intergenic
1024805257 7:53132004-53132026 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025480920 7:60981768-60981790 GAAAATAAAGAGACAAAGGAAGG + Intergenic
1025488117 7:61077267-61077289 GAAAATAAACAGGTGAAGGAAGG - Intergenic
1025879348 7:65520015-65520037 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1025885147 7:65582916-65582938 GAAAATAAAGAGGAGAAGGAAGG - Intergenic
1026206768 7:68264440-68264462 GACTATAAACTGCAAAAGGCAGG - Intergenic
1026744066 7:72997611-72997633 GAAAGTCAACAGGAAAAGGAGGG + Intergenic
1026804313 7:73420232-73420254 GAAAGTCAACAGGAAAAGGAGGG + Intergenic
1026900936 7:74037133-74037155 GAGGATAAAAAGAAATAGGAAGG - Intronic
1027030172 7:74882288-74882310 GAAAGTCAACAGGAAAAGGAGGG + Intergenic
1027099671 7:75367481-75367503 GAAAGTCAACAGGAAAAGGAGGG - Intergenic
1027644375 7:80778818-80778840 GAGAACAAACACTAAAAGGAAGG - Intronic
1027757352 7:82231110-82231132 AAGCACAAACAACAAAAGGAAGG - Intronic
1027766747 7:82353533-82353555 GAGAGTGTACAGCGAAAGGAAGG + Intronic
1028285062 7:88986366-88986388 AAAACTAAACAGCAAAAGCAGGG - Intronic
1028526015 7:91787505-91787527 GAGAACAATCAGCATATGGAAGG + Intronic
1028828619 7:95302889-95302911 GAGAATAAACAGCAGAAGAACGG - Intronic
1029230633 7:99065475-99065497 GAGAAAATGCAACAAAAGGAAGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030641522 7:112011569-112011591 GAGAATTAACAACATCAGGAGGG + Intronic
1030927196 7:115472957-115472979 GAGAATAAACAGGAAACTGAAGG + Intergenic
1031780504 7:125956447-125956469 GAGAATAAAATGCCACAGGAAGG - Intergenic
1032398044 7:131604854-131604876 GAGAAGAGACAGTCAAAGGATGG + Intergenic
1032426742 7:131828827-131828849 GAAAAGAAAAAGAAAAAGGAAGG - Intergenic
1032448000 7:132001168-132001190 GAGCAAAAAAAGCAAAAGTATGG + Intergenic
1032599174 7:133274890-133274912 GAAAGTAAAATGCAAAAGGAAGG - Intronic
1032761366 7:134946665-134946687 GAGAAAAAAAAAAAAAAGGAAGG - Intronic
1032763541 7:134967820-134967842 GAAAAAAATCAGCAGAAGGAAGG + Intronic
1034289620 7:149919238-149919260 AAAAAAAAAAAGCAAAAGGATGG - Intergenic
1034479760 7:151310452-151310474 AAGAACATACAGGAAAAGGATGG + Intergenic
1035115730 7:156522355-156522377 GAAAATAAAAAGCAAACTGATGG - Intergenic
1036215667 8:6877825-6877847 GAGAGTAAACAGCAGAAGGTAGG + Exonic
1036453069 8:8885623-8885645 GAAGGAAAACAGCAAAAGGAAGG + Intronic
1036677869 8:10850238-10850260 GAGAAATAATAGCAAAGGGAGGG - Intergenic
1036917736 8:12821027-12821049 CAGAATAAACAGCAGAATAAGGG - Intergenic
1037036373 8:14173255-14173277 GAGAAAAATCAGCAATAGAATGG + Intronic
1037181130 8:16006888-16006910 GAGAATACATAGTCAAAGGAAGG + Intergenic
1038698680 8:29829201-29829223 GTGAATAAATAGAAAAGGGAAGG + Intergenic
1038943190 8:32328593-32328615 GAGTATGTACAGCAAAAGTAAGG + Intronic
1039143557 8:34420268-34420290 GAAGATGAACATCAAAAGGAAGG - Intergenic
1039271556 8:35886709-35886731 AAGAACAAAAAGCAAAGGGAAGG + Intergenic
1039342895 8:36671072-36671094 GAGAATAAAGAGTAAAAAAAAGG - Intergenic
1041472012 8:58221074-58221096 GAGAATAAAAAGAAAAATGATGG - Intergenic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042498660 8:69485145-69485167 GGGAAGAAACCACAAAAGGAAGG - Intronic
1043150470 8:76708146-76708168 GAGAAAAAACATCAAAGGGCAGG + Intronic
1043285593 8:78525779-78525801 AAAAATAAATAGCAAAAGGGAGG - Intronic
1043994823 8:86800007-86800029 GGAAAAAAACAGAAAAAGGAAGG + Intergenic
1044089843 8:87986358-87986380 GAGAATTAAAAGCAAAAATATGG - Intergenic
1044399815 8:91757771-91757793 GATAATGAAAAGCAAAAAGAGGG - Intergenic
1044476249 8:92629923-92629945 GAGAACAAACAGTTAAATGATGG - Intergenic
1044595809 8:93957191-93957213 GAGAAGAAACAGCAACAACAGGG + Intergenic
1044658593 8:94573463-94573485 GAGAATACACATTATAAGGAAGG + Intergenic
1044747278 8:95382969-95382991 GATAAGAACCAGCAAAAGGGTGG + Intergenic
1045518207 8:102879721-102879743 GAGATTACACACCAAAAGGTGGG - Intronic
1046117927 8:109806758-109806780 GAGAATAAAATGAAAAGGGATGG + Intergenic
1047082358 8:121477149-121477171 GAGAATAAGAAGTCAAAGGAAGG - Intergenic
1047190492 8:122674746-122674768 GAGAATAAACTGGAAAGAGATGG + Intergenic
1047376876 8:124307633-124307655 GACAATTTAAAGCAAAAGGAAGG + Intergenic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049846880 8:144807164-144807186 GAGAAGGAACAGAAAACGGAAGG - Intronic
1049938893 9:525766-525788 GAGAATAAGCAGCAAAGGTTGGG + Intronic
1050224116 9:3431649-3431671 GACAATTTAAAGCAAAAGGAAGG + Intronic
1050640872 9:7666279-7666301 GATAAGAAACATCATAAGGAGGG + Intergenic
1050681728 9:8119149-8119171 GTCAATAAACAGCAAAAGTGTGG - Intergenic
1050839684 9:10132857-10132879 GGGCATAAACACCAGAAGGAAGG - Intronic
1050892747 9:10845519-10845541 TAGAATAAAGAGCAAAAGAATGG - Intergenic
1050963212 9:11764892-11764914 GAAAATAGAGAGCAGAAGGATGG + Intergenic
1051029273 9:12655465-12655487 AAAAATAAACAGAAAAAGAAAGG - Intergenic
1051424473 9:16919633-16919655 AAGAGTAAACATCTAAAGGAGGG + Intergenic
1052014285 9:23446955-23446977 GAGAATCAACAGCAATAAAATGG + Intergenic
1052058447 9:23929279-23929301 GAGACTAAAAAGAAAAAAGAAGG + Intergenic
1052130802 9:24844302-24844324 GAGAATAAACAGAAACACTATGG - Intergenic
1054771220 9:69086132-69086154 GTGCAGAAACTGCAAAAGGAAGG + Intronic
1055411775 9:76038122-76038144 GAGAATGAACCTCAGAAGGAGGG - Intronic
1056944121 9:90979187-90979209 GAGAGAAAACAGGAAATGGATGG - Intergenic
1057686431 9:97238580-97238602 TAAAATAAATAGCAAAGGGAAGG - Intergenic
1059011231 9:110463567-110463589 GAGAAAATAAAGAAAAAGGAAGG + Intronic
1059514364 9:114879164-114879186 GAGAAGAATGAGCAAAAGGGGGG - Intergenic
1059701542 9:116779684-116779706 GAAAATGAACAGAAAAAGAAGGG - Intronic
1059940366 9:119353305-119353327 AAGGATAAAGAGGAAAAGGAGGG - Intronic
1061337831 9:129953596-129953618 GAGATTAAACAGTAAAAGAAAGG + Intronic
1062404208 9:136387116-136387138 GAAAATAAGCAGGAAAAGGAGGG + Intronic
1202780790 9_KI270717v1_random:34915-34937 GAAAATAAAGAGGCAAAGGAAGG - Intergenic
1203581732 Un_KI270746v1:13098-13120 GAAAATAAAGAGGAGAAGGACGG + Intergenic
1185611106 X:1394209-1394231 GAGAAGAAAAAGGAAAAGGAGGG - Intergenic
1185667373 X:1776677-1776699 GAGAAGAAACAAGGAAAGGAAGG - Intergenic
1185783070 X:2865938-2865960 GTGAATAAACTGCAAAAACATGG - Intronic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187121515 X:16412085-16412107 GACAATTTAAAGCAAAAGGAAGG + Intergenic
1187259401 X:17671253-17671275 GAGAAGAAAAAGCAAAAGAGGGG + Intronic
1187454652 X:19430635-19430657 GAGAAGGAACATCAAATGGAGGG - Intronic
1187718905 X:22131534-22131556 AAGAACAAACAGCAGATGGAAGG - Intronic
1187788221 X:22917728-22917750 GACAGTACACAGAAAAAGGAGGG + Intergenic
1187807715 X:23139300-23139322 GGGCAAAAAAAGCAAAAGGAAGG + Intergenic
1188204837 X:27343236-27343258 GAAGAAAAACAGCACAAGGAGGG + Intergenic
1188550241 X:31356355-31356377 GAGAAAGGACAGAAAAAGGAGGG - Intronic
1188727268 X:33601391-33601413 GAGAATCAACAACAAAAACAAGG - Intergenic
1189166526 X:38866488-38866510 AAGAATAAAAAGAGAAAGGAGGG - Intergenic
1189512609 X:41678293-41678315 GAAAAAAAAAAGCATAAGGAAGG - Intronic
1189540246 X:41979985-41980007 CAGAAGGAACAGAAAAAGGAAGG + Intergenic
1189567864 X:42261956-42261978 GAGAATAAATGGCAGAAGGAAGG - Intergenic
1189731074 X:44021713-44021735 GGGAATAAACACCAAAAAGAAGG + Intergenic
1190744071 X:53310766-53310788 GACAAAAAACAGCAGAAAGAAGG + Intronic
1192436444 X:71146106-71146128 GAGAAGAAAAAGGAAGAGGAGGG - Intronic
1193259369 X:79387321-79387343 GAAAACAGACAGCAAAAGAATGG + Intergenic
1193684942 X:84566519-84566541 AAGAATAAATAGCAAAATAAAGG + Intergenic
1194402159 X:93451710-93451732 TAGAATAAACAACAAAATTAAGG - Intergenic
1194734925 X:97500931-97500953 TGGAATAAAAAGCAAAAGGAAGG - Intronic
1194853281 X:98895897-98895919 GATAATAAACAGCAAGAGTTAGG + Intergenic
1195133257 X:101876115-101876137 GAACATAAAAAGCAGAAGGATGG + Intergenic
1195478156 X:105311314-105311336 GAAAATACACAGCAAATAGAAGG - Intronic
1195657203 X:107343371-107343393 GTGAATAAACTGCAAAAGAGAGG - Intergenic
1195997834 X:110749012-110749034 GAGAATGAAAATAAAAAGGAAGG + Intronic
1196286543 X:113887750-113887772 GAGTATAGACAGTAGAAGGATGG - Intergenic
1196320798 X:114337816-114337838 GAAATGAAACAGCAAAATGATGG + Intergenic
1197182809 X:123554268-123554290 GTGACTACTCAGCAAAAGGATGG + Intergenic
1197228653 X:123979260-123979282 CAAAATAAACTGAAAAAGGAGGG - Intronic
1197292798 X:124680639-124680661 AAGAATAAGCAGCATAATGATGG + Intronic
1197344076 X:125310809-125310831 TAAAATAAACAGAAAAAGAATGG + Intergenic
1198012597 X:132573850-132573872 GAGACTAAACAGGAAAAGTATGG + Intergenic
1198624215 X:138550953-138550975 GACTATAAACAACTAAAGGATGG - Intergenic
1199652476 X:149960189-149960211 GAGAACACACAGCAAGAAGATGG - Intergenic
1200641488 Y:5723617-5723639 GAAAATAAAAAGAAAAATGACGG + Intronic
1201628111 Y:16037861-16037883 TAAAATAAACAGAAAAAGAATGG + Intergenic
1202329671 Y:23734847-23734869 GAGTATAAACAGCAAAATTCAGG - Intergenic
1202541100 Y:25935207-25935229 GAGTATAAACAGCAAAATTCAGG + Intergenic