ID: 944174170

View in Genome Browser
Species Human (GRCh38)
Location 2:196811365-196811387
Sequence CTACTGTGTAACCACCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944174170_944174175 10 Left 944174170 2:196811365-196811387 CCAGTTAGGTGGTTACACAGTAG 0: 1
1: 1
2: 1
3: 5
4: 81
Right 944174175 2:196811398-196811420 AAAAGATGTTAACTTGGATTAGG 0: 1
1: 0
2: 5
3: 47
4: 526
944174170_944174174 4 Left 944174170 2:196811365-196811387 CCAGTTAGGTGGTTACACAGTAG 0: 1
1: 1
2: 1
3: 5
4: 81
Right 944174174 2:196811392-196811414 GGCAGGAAAAGATGTTAACTTGG 0: 1
1: 0
2: 0
3: 17
4: 287
944174170_944174176 11 Left 944174170 2:196811365-196811387 CCAGTTAGGTGGTTACACAGTAG 0: 1
1: 1
2: 1
3: 5
4: 81
Right 944174176 2:196811399-196811421 AAAGATGTTAACTTGGATTAGGG 0: 1
1: 0
2: 4
3: 51
4: 740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944174170 Original CRISPR CTACTGTGTAACCACCTAAC TGG (reversed) Intergenic
905947285 1:41914180-41914202 CAACTGTGAAACCTCCCAACAGG + Intronic
906509901 1:46405037-46405059 CAACTGTGTGACCTCCTATCTGG + Exonic
907120767 1:52006193-52006215 CCACTTTGTAACCACCCAATGGG + Intergenic
907709859 1:56869518-56869540 CTACTGGGTATCTACCTAAGCGG - Intronic
918279814 1:182993407-182993429 CTCCTGTGTAACCACCATCCAGG - Intergenic
921259416 1:213372336-213372358 CTATTGAGAAACCACCTATCAGG + Intergenic
923323889 1:232863192-232863214 CTAATGTTTAACTATCTAACTGG - Intergenic
1064053696 10:12079889-12079911 CTATTATGGATCCACCTAACTGG + Intronic
1069770791 10:70898555-70898577 CTACTCTGATACCACCCAACGGG + Intergenic
1071252688 10:83837058-83837080 CTTCTGTGTAAAATCCTAACTGG - Intergenic
1073258127 10:102168402-102168424 CTACTCGATACCCACCTAACAGG - Intergenic
1080353458 11:31412824-31412846 CTTCTGTGTAACCAAATACCAGG + Intronic
1083736575 11:64685066-64685088 CTACTATGCCACCACCTCACTGG + Intronic
1087827853 11:102786727-102786749 CTAGTGGGTAACTACCTAGCAGG - Intergenic
1090703118 11:129314166-129314188 CTACTGTGGAACCAAATTACAGG + Intergenic
1093616711 12:21233924-21233946 CTAGTGTGTAACCACCTAACGGG + Intronic
1095541146 12:43310081-43310103 CTGCTTTGTAACGACCTAGCAGG - Intergenic
1095887544 12:47204944-47204966 CAATAGTGTAACCACCTAACAGG + Intronic
1097847413 12:64380942-64380964 CCACAATGTAACCACCCAACAGG + Intronic
1098541106 12:71658643-71658665 CTTCTGTTTAAACACCTCACAGG + Intronic
1104009582 12:124920256-124920278 CCAATGCGTCACCACCTAACTGG + Intergenic
1105593348 13:21813900-21813922 CAACTGTCAAATCACCTAACAGG - Intergenic
1111674785 13:91373895-91373917 CTGCTGTGTAAGCAAGTAACAGG + Intergenic
1114438463 14:22727295-22727317 TTACAGTGTAACCACCCAATGGG + Intergenic
1116423314 14:44759665-44759687 ATACTGTTTTACCACCTATCTGG - Intergenic
1118344419 14:64926545-64926567 CAACTGTGCAATCACGTAACTGG - Intronic
1132948158 16:2544198-2544220 ACACTTTGTAACCACCTATCAGG - Intronic
1132966287 16:2656929-2656951 ATACTTTGTAACCACCTGTCAGG + Intergenic
1133393480 16:5427869-5427891 ATACTGTGTGACCATCTATCTGG + Intergenic
1140840714 16:78836439-78836461 CTACTGTGGACCCACCTGAAGGG + Intronic
1141175563 16:81716675-81716697 CTTGTATGTAACCACCCAACAGG + Intergenic
1149135459 17:53358816-53358838 CTACTTTGGAACCGCATAACAGG + Intergenic
1149197054 17:54133420-54133442 CTTCTGTGTTTCCACCTAAGGGG - Intergenic
1155689937 18:28607539-28607561 CTTCTAGGTAACCACCTGACTGG - Intergenic
1165714875 19:38037872-38037894 CTGCTGTGTCACCAGCTCACAGG - Intronic
1165886327 19:39081604-39081626 CAACTGTGTAACCACCAACCGGG - Intergenic
928894528 2:36245078-36245100 CTACTGGGTATCTACCTAAAGGG - Intergenic
928993093 2:37256278-37256300 CTTCTCTTTAACCACCTTACAGG - Intronic
932318113 2:70799846-70799868 CGACTTTGTAACTAGCTAACAGG - Intergenic
939131823 2:138244281-138244303 TAACTGTGTAATCACCCAACAGG + Intergenic
940125488 2:150318586-150318608 CTACTATATAACCACCAAAGTGG - Intergenic
940143665 2:150522958-150522980 CAACTGTGGAACCAGGTAACAGG + Intronic
941878041 2:170454677-170454699 CAAATTTGTAACCACCTAACGGG + Intronic
944174170 2:196811365-196811387 CTACTGTGTAACCACCTAACTGG - Intergenic
947216323 2:227753412-227753434 CTGCTGTATAACCACCCAATGGG - Intergenic
1170312729 20:15010281-15010303 ATAATGTGTAACTACCTAAGTGG - Intronic
1184296684 22:43529491-43529513 CTCCTCTGTATCCAGCTAACCGG + Intronic
957158284 3:76574738-76574760 TTAATGTGTAAACACCTCACTGG + Intronic
957648015 3:82959730-82959752 CTACTGAATGTCCACCTAACAGG + Intergenic
959271336 3:104214532-104214554 CAACTCTGTTTCCACCTAACAGG - Intergenic
962623604 3:137202968-137202990 CTACTTTAGAACAACCTAACTGG + Intergenic
964192994 3:154027362-154027384 CTAGTGTTTAACCAAATAACTGG + Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
967327370 3:188254810-188254832 CTGCAGTGTAACATCCTAACAGG + Intronic
972932755 4:44093958-44093980 CTATTGTGTAACCACCTCCCAGG + Intergenic
973023763 4:45239542-45239564 CTAGTGTTTAACCAAATAACTGG - Intergenic
976302136 4:83525327-83525349 TTACTGTGTAATCACCTAACAGG + Intergenic
977901483 4:102427064-102427086 CTACTATGTACCCACAAAACTGG + Intronic
978637293 4:110824612-110824634 CTGCTGTGTGGCCCCCTAACAGG + Intergenic
981279292 4:142938958-142938980 ATACTGTTTTACCAGCTAACTGG - Intergenic
983947150 4:173599060-173599082 CAACAGTGTGACCACCCAACAGG + Intergenic
984148816 4:176100082-176100104 CTACTGTGTATCTACCCAAAAGG - Intronic
985347614 4:189023101-189023123 TATCTGTGTAACCACCCAACTGG - Intergenic
989678841 5:44005833-44005855 TTACTGTGTAACCAAATCACTGG + Intergenic
995999180 5:118338018-118338040 CTACTGTGTATCTACCCAAAAGG + Intergenic
1000725367 5:164763090-164763112 CAAATGTGTAACCACCCAATGGG + Intergenic
1000848840 5:166315174-166315196 CTAGTTTGTAACCATGTAACAGG + Intergenic
1004196261 6:13508401-13508423 CATCTGTGTAACCACCTTCCGGG + Intergenic
1007146892 6:39644303-39644325 CTGCTGTGTATACACCTAGCCGG - Intronic
1009463026 6:63936641-63936663 CTTCTGTTTATCCATCTAACTGG + Intronic
1015198846 6:130555221-130555243 CTACTGGGTAACTACCCAAAGGG + Intergenic
1023111929 7:36822078-36822100 ATAATGTTTAACCACATAACTGG + Intergenic
1024217293 7:47258196-47258218 CCACTGGGTAAACACCTAAGAGG + Intergenic
1028255641 7:88593521-88593543 CTACAGTAAACCCACCTAACAGG + Intergenic
1033783938 7:144707014-144707036 CTTCTGCGTAACCATCTAAGAGG + Intronic
1041505750 8:58595799-58595821 CTAACGTGGAACCATCTAACAGG - Intronic
1042198399 8:66254387-66254409 TTCTTGTGTAACCACCCAACAGG - Intergenic
1043991942 8:86765929-86765951 CCACTGTGTAATCACCCAAGGGG - Intergenic
1044987667 8:97769442-97769464 CCTCTGTGTAACCACCCAAGGGG + Intergenic
1049065748 8:140312385-140312407 CTACTGTGCTACCACCTTAGGGG + Intronic
1052082416 9:24223515-24223537 TTCCTGTGTAACCACCACACAGG - Intergenic
1058340235 9:103886517-103886539 CTACTATGTAACCATCAAAGAGG + Intergenic
1059133190 9:111776824-111776846 CAACTTTGTAACCGCCCAACGGG + Intronic
1188747289 X:33861907-33861929 CTGTTGTGTAACCACCCAACAGG + Intergenic
1192812442 X:74559344-74559366 CAAATTTGTAACCACCTGACAGG - Intergenic
1193617675 X:83710247-83710269 CCAGTGTTTAAACACCTAACTGG + Intergenic
1194211708 X:91077978-91078000 ATAATGTGTAACCAGCTACCTGG + Intergenic
1197025514 X:121744325-121744347 ATAATGTTTAACCACCTATCTGG - Intergenic
1202048005 Y:20753392-20753414 CAGCTCTGTAACCACCCAACAGG + Intergenic