ID: 944175212

View in Genome Browser
Species Human (GRCh38)
Location 2:196821198-196821220
Sequence TAGGGTGTCCAGAGGTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944175201_944175212 23 Left 944175201 2:196821152-196821174 CCAGCAGCCAACAGAAGCTGGAA No data
Right 944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG No data
944175203_944175212 16 Left 944175203 2:196821159-196821181 CCAACAGAAGCTGGAAGAGGAAG No data
Right 944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944175212 Original CRISPR TAGGGTGTCCAGAGGTGGCA TGG Intergenic
No off target data available for this crispr