ID: 944175872

View in Genome Browser
Species Human (GRCh38)
Location 2:196828883-196828905
Sequence CCTCAGATGGGACAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944175865_944175872 22 Left 944175865 2:196828838-196828860 CCCTAGGACCACATAAAAGTGAA No data
Right 944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG No data
944175867_944175872 14 Left 944175867 2:196828846-196828868 CCACATAAAAGTGAATTCTGACA No data
Right 944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG No data
944175866_944175872 21 Left 944175866 2:196828839-196828861 CCTAGGACCACATAAAAGTGAAT No data
Right 944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG No data
944175864_944175872 28 Left 944175864 2:196828832-196828854 CCTCAGCCCTAGGACCACATAAA No data
Right 944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944175872 Original CRISPR CCTCAGATGGGACAGCAACC TGG Intergenic
No off target data available for this crispr