ID: 944176970

View in Genome Browser
Species Human (GRCh38)
Location 2:196841291-196841313
Sequence TTGGGTCAGCACATTTATAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944176970_944176974 8 Left 944176970 2:196841291-196841313 CCTATATAAATGTGCTGACCCAA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 944176974 2:196841322-196841344 ACACCAACAGCCAGAGGAAGTGG 0: 1
1: 0
2: 0
3: 37
4: 402
944176970_944176973 2 Left 944176970 2:196841291-196841313 CCTATATAAATGTGCTGACCCAA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 944176973 2:196841316-196841338 GCAATCACACCAACAGCCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944176970 Original CRISPR TTGGGTCAGCACATTTATAT AGG (reversed) Exonic
903200611 1:21735080-21735102 TTGGGTCAGGAAATTTATTTTGG - Intronic
904101453 1:28032411-28032433 GTTGGTCAGCACATTTTTGTGGG + Intronic
910078189 1:83305554-83305576 TTGTGTTAGAACATTTATACAGG - Intergenic
913528670 1:119716804-119716826 GTGGGTAAGCACATTTTTAGTGG - Intronic
915841880 1:159219736-159219758 GTTGGTCAGCAAATTCATATAGG - Intergenic
921373867 1:214453063-214453085 CTGGGTCTGCAGCTTTATATAGG - Intronic
921481411 1:215668131-215668153 CTGGGTGAGCAGATTTATATAGG + Intronic
1065363413 10:24911020-24911042 TGAGGTCAGCACATTTTAATTGG - Intronic
1065807366 10:29406776-29406798 TTATGTTAGCACATTTATACAGG + Intergenic
1066747898 10:38620232-38620254 TTCTGACAGCACATTTCTATTGG - Intergenic
1067508224 10:46874335-46874357 TTGAGTAAACACAGTTATATGGG - Intergenic
1067654027 10:48177510-48177532 TTGGGTAAACACAGTTATATGGG + Intronic
1069956634 10:72056008-72056030 TTGGGTCAGCACCTCTCCATGGG - Intergenic
1071175194 10:82917878-82917900 TTGGCTTAGCCCCTTTATATTGG + Intronic
1079480081 11:20870993-20871015 TTGTATTGGCACATTTATATTGG + Intronic
1080852428 11:36081380-36081402 TTTGTTCAGCACATTTTGATTGG + Intronic
1093657767 12:21716754-21716776 TTGGGAGAGAACATTCATATGGG - Intronic
1097471312 12:59996165-59996187 TTGAGTGACCACTTTTATATAGG + Intergenic
1107055882 13:36102991-36103013 ATGAGTCTGCACATTTATGTGGG - Intronic
1107812020 13:44209606-44209628 TTTGGTCAGCACTTTCATGTGGG - Intergenic
1113640309 13:111952585-111952607 TTGGCTCAGCATATATTTATGGG - Intergenic
1115535128 14:34365790-34365812 TGGGGTCAACACATTTTTTTGGG - Intronic
1116078196 14:40140165-40140187 TTGGTACATAACATTTATATTGG - Intergenic
1123754244 15:23384312-23384334 TTGGGTCAGCTTATTGATAAGGG + Intergenic
1124355897 15:28994592-28994614 TTGGGTCATCTCCTTTACATGGG + Intronic
1127034298 15:54897921-54897943 GTGTGTCAGCACATATATCTAGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1138012424 16:53394942-53394964 GTGGGTCAGCCCATTTGTCTGGG + Intergenic
1138902103 16:61285366-61285388 TCAGGTCAGAATATTTATATGGG + Intergenic
1143629111 17:8127029-8127051 TTCGGTCAGCCCATATTTATGGG + Intergenic
1146898715 17:36566262-36566284 TTGTTGCAGCACATTTATCTTGG - Intronic
1151224135 17:72636181-72636203 TTTGGTCACCACCTTTATTTTGG - Intergenic
1155386274 18:25281404-25281426 TTGGGTCAGCAAACTTAATTTGG - Intronic
1158358452 18:56646132-56646154 TTGGGCCAGCACCTTGATCTTGG - Intronic
1163056545 19:14724149-14724171 CTGGGTCAGCTCATTAAGATAGG - Intronic
1164405211 19:27938108-27938130 ATGGGTCTCCACATTTATTTTGG + Intergenic
1165109019 19:33490388-33490410 TGGGGAGAGCAGATTTATATTGG - Intronic
1167658996 19:50784844-50784866 GCGGGTCTGCACATTTTTATAGG + Intergenic
930517701 2:52429419-52429441 TATGGTCAGCTAATTTATATGGG + Intergenic
931146357 2:59523650-59523672 TTGGGTCAGCGCATATAGACTGG - Intergenic
939244710 2:139609269-139609291 TTGACTCAGCACATTCATAGTGG - Intergenic
944176970 2:196841291-196841313 TTGGGTCAGCACATTTATATAGG - Exonic
944964000 2:204908333-204908355 TTTGGACAACTCATTTATATGGG - Intronic
946228139 2:218275679-218275701 TTTGGTCAGCAGATTTGTCTTGG + Intronic
947311181 2:228804474-228804496 TTGGAACAGCAGATTTATATGGG - Intergenic
1172115261 20:32569881-32569903 TTTGTTCAGCACATTTTGATTGG - Intronic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1181037903 22:20178718-20178740 TTCGCTCAGAACATTTTTATGGG + Intergenic
953071055 3:39520188-39520210 ATGGGTCAGCACACTTATCAGGG - Intronic
955116199 3:56005869-56005891 TTTGAAGAGCACATTTATATAGG + Intronic
955142850 3:56286618-56286640 AGGGGTCAGCACATTTAAAGAGG + Intronic
959070420 3:101696688-101696710 TTCGGTCAGCACAAGTAAATAGG + Intergenic
960854824 3:122092207-122092229 TTGTGTCAGCTGATTTATAGTGG + Intronic
965218121 3:165891685-165891707 TAGGGTTAACACATTTAGATGGG + Intergenic
967453864 3:189658275-189658297 TTGGATAAGCAAATTAATATAGG + Intronic
970337351 4:15062291-15062313 TTGGATCAGCACCTTATTATAGG - Intronic
973842976 4:54881181-54881203 AAGGGTCAGCAAATTTAAATGGG + Intergenic
973915304 4:55628085-55628107 TTGGCACAGCATATTTATCTAGG + Intronic
977944022 4:102890328-102890350 TTCTGACAGCACATTTCTATTGG - Intronic
986777678 5:11033157-11033179 TTTTGTCAGCACATGTTTATTGG - Intronic
990149753 5:52802752-52802774 TTGGGTTTGCACATTTTTATTGG + Exonic
990477659 5:56176653-56176675 TGGGTTCAGCACACTTTTATAGG + Intronic
991344720 5:65651627-65651649 CTGGTTTAGCACATTTATGTGGG + Intronic
993531601 5:89031820-89031842 TTGGGGCAGCAAATTCACATGGG - Intergenic
997676412 5:135716357-135716379 TTTTATCAACACATTTATATGGG + Intergenic
999080659 5:148840341-148840363 TTGGGTCAGCGTATTTCTGTGGG + Intergenic
1001823625 5:174728507-174728529 TTGCGTCAGCATATTTATGAAGG - Intronic
1005275615 6:24214101-24214123 TTTTATCCGCACATTTATATGGG + Intronic
1008473643 6:51912286-51912308 TGGGGTCTGGACATTTGTATTGG - Intronic
1010104730 6:72153750-72153772 TTGGGTCTGCCCATTTATACTGG + Intronic
1014153271 6:118083316-118083338 TTAGGTCAGCCCACTTATCTTGG - Intronic
1014574371 6:123052338-123052360 TTGCCTCAGAACATTTATAATGG - Intronic
1019210827 6:170403321-170403343 TTGGGGCAGCACATTTCTCCTGG + Intronic
1023632219 7:42176202-42176224 TTGGGTCAGCACCAGCATATGGG - Intronic
1027295962 7:76770728-76770750 TTGTGTTAGAACATTTATACAGG - Intergenic
1033312717 7:140273520-140273542 TGGGGTCAGCACAGCTATAGGGG + Intergenic
1034249483 7:149676708-149676730 TTGGGTCACCTCCCTTATATGGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG + Intronic
1043858171 8:85285714-85285736 TTGGGTGAGCTCATTGCTATTGG + Intergenic
1047029118 8:120857419-120857441 CTGGGTCATTACATTCATATTGG - Intergenic
1051135895 9:13919960-13919982 TTCGGTCAGTAAATATATATTGG - Intergenic
1058644323 9:107116478-107116500 CTGGGTAAGCTCATTTAGATAGG - Intergenic
1185793379 X:2944703-2944725 CTGGGTGAGCACCTGTATATGGG - Intronic
1188995520 X:36880401-36880423 TTGAGTAATCACATTCATATTGG + Intergenic
1193014564 X:76717963-76717985 TTGGTTCAGCACATTACTACTGG + Intergenic
1194568844 X:95527786-95527808 TTGAGTCAGTAGATTTCTATAGG - Intergenic
1195539425 X:106045700-106045722 TGAGGTCAGCACCTTTATTTGGG + Intergenic
1199156234 X:144551750-144551772 TTGGCTCAGCACAGTCATACTGG + Intergenic