ID: 944177675

View in Genome Browser
Species Human (GRCh38)
Location 2:196850926-196850948
Sequence AAATTGATAATTAGAGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944177675_944177679 19 Left 944177675 2:196850926-196850948 CCTATAGCTCTAATTATCAATTT No data
Right 944177679 2:196850968-196850990 GTTCAACTCCAGCAAGGGGATGG No data
944177675_944177676 13 Left 944177675 2:196850926-196850948 CCTATAGCTCTAATTATCAATTT No data
Right 944177676 2:196850962-196850984 AAACATGTTCAACTCCAGCAAGG No data
944177675_944177677 14 Left 944177675 2:196850926-196850948 CCTATAGCTCTAATTATCAATTT No data
Right 944177677 2:196850963-196850985 AACATGTTCAACTCCAGCAAGGG No data
944177675_944177678 15 Left 944177675 2:196850926-196850948 CCTATAGCTCTAATTATCAATTT No data
Right 944177678 2:196850964-196850986 ACATGTTCAACTCCAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944177675 Original CRISPR AAATTGATAATTAGAGCTAT AGG (reversed) Intronic
No off target data available for this crispr