ID: 944177679

View in Genome Browser
Species Human (GRCh38)
Location 2:196850968-196850990
Sequence GTTCAACTCCAGCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944177675_944177679 19 Left 944177675 2:196850926-196850948 CCTATAGCTCTAATTATCAATTT No data
Right 944177679 2:196850968-196850990 GTTCAACTCCAGCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944177679 Original CRISPR GTTCAACTCCAGCAAGGGGA TGG Intronic
No off target data available for this crispr