ID: 944179421

View in Genome Browser
Species Human (GRCh38)
Location 2:196872245-196872267
Sequence ATTTGCAAATGGCCCAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944179421 Original CRISPR ATTTGCAAATGGCCCAGCTA TGG Intronic
900567382 1:3340207-3340229 GTGTGCAAAGGGCCCAGGTAAGG - Intronic
901196552 1:7443538-7443560 CTTGGCATATGGCCCTGCTAGGG + Intronic
903240369 1:21978633-21978655 AGTTGCAAATAGCCCAGTGAGGG - Intronic
903244115 1:22003267-22003289 AGTTGCAAATAGCCCAGTGAGGG - Intronic
903609717 1:24601748-24601770 ATTTGCATATGGGCCAGGCACGG + Intronic
907029114 1:51153289-51153311 ATTTGCAGATGGGCCAGCAAGGG - Intergenic
907567236 1:55446776-55446798 TTTTGCAAATGGCAAAGCTGAGG + Intergenic
911085641 1:93975140-93975162 ATTTAAAACTGGCCCAACTAGGG - Intergenic
911357418 1:96839326-96839348 AATTGGAAATGGCCCTGCTAGGG - Intergenic
912078650 1:105909959-105909981 CTCTGCAAATGGCACAGCTCAGG - Intergenic
912782367 1:112563230-112563252 ATTTGGAAATGGCAGAGGTAAGG + Intronic
913064402 1:115237229-115237251 AGTTGCAAATGACCCTGATAAGG + Intergenic
916558945 1:165916227-165916249 ATTGGCAAAGGGCCCAGAAATGG - Intergenic
916839369 1:168584176-168584198 TGTTCCAAATGGCCCAGCTCAGG + Intergenic
918699584 1:187591109-187591131 ATTTGCATAGGGCTCACCTATGG + Intergenic
919045840 1:192450753-192450775 ATTTTCAAATGGTCCAGAAATGG + Intergenic
920780400 1:208985515-208985537 ATTTTAATAGGGCCCAGCTATGG - Intergenic
922669522 1:227498406-227498428 ATTTGAAAATGCCCTAGCTAAGG - Intergenic
922670071 1:227502896-227502918 ATTTGAAAATGCCCTAGCTAAGG + Intergenic
924242391 1:242053796-242053818 ATTTGAAAATGCTCTAGCTAAGG + Intergenic
1064647145 10:17471329-17471351 ATTTGAAAATGGCAGATCTATGG + Intergenic
1065633443 10:27706466-27706488 GATTGTAAATGGCACAGCTATGG - Intronic
1069552162 10:69371976-69371998 TTTTGTAAATTGCCCAGTTACGG - Intronic
1070692665 10:78539183-78539205 CTGTGCACATGGCACAGCTAGGG - Intergenic
1072919709 10:99566008-99566030 ACTTGCAAAGGGCCCTGCTCTGG - Intergenic
1073196562 10:101695677-101695699 ATCAGGAAATGGCACAGCTAGGG + Intergenic
1073948007 10:108774891-108774913 AACTGCAAATAGCCAAGCTACGG - Intergenic
1073983076 10:109177182-109177204 ATTTGTAAATTGCCCAGTTTCGG - Intergenic
1074260934 10:111852572-111852594 ATTTACAAATTGCTCAGCTTGGG + Intergenic
1074953652 10:118365754-118365776 GTGTGCAAATAGCCCAGCTAAGG + Intergenic
1075445721 10:122511347-122511369 GCTAGCAAATGGCCGAGCTAGGG + Intronic
1076065367 10:127443975-127443997 CTTTGCAAATGATCAAGCTAAGG - Intronic
1076080477 10:127576083-127576105 ATTGGCAAAAGTCCCAGCCAAGG + Intergenic
1078519356 11:12050987-12051009 ATATGAATAGGGCCCAGCTATGG + Intergenic
1083682994 11:64359773-64359795 TTTTGCAAATGCCCCAGCGCTGG + Intronic
1088340821 11:108764375-108764397 GTTTGCAAATGGGCCAGGTGCGG + Intronic
1089607567 11:119650477-119650499 ATCAGCAAATGCCCCAGGTAGGG - Intronic
1089673060 11:120069952-120069974 ATTTGCAAATGGCACAATTTAGG + Intergenic
1090437391 11:126698028-126698050 AATGGCAAATGGCACAGCTGAGG + Intronic
1090655156 11:128837610-128837632 AGTTCCACATGGGCCAGCTATGG + Intronic
1092578150 12:9812500-9812522 TTTTGGAAATTTCCCAGCTATGG + Intergenic
1093772698 12:23035978-23036000 TTTTGCAAATGCCTCTGCTATGG - Intergenic
1095947150 12:47759678-47759700 CTGTGCAAATGGCCCAGCGCGGG + Intronic
1100827698 12:98490207-98490229 ATTTTGAAATGGCCCTGCAAAGG - Intronic
1101566316 12:105909287-105909309 AGTAGCAAATGTCCTAGCTATGG + Intergenic
1102596960 12:114000296-114000318 TTTTGTAAATTGCCCAGCTTGGG - Intergenic
1103292199 12:119855613-119855635 AATTCCAAATGGCTCAGTTAAGG + Intronic
1107378955 13:39834931-39834953 ACTTGTAAATGGCTCAGCTAGGG + Intergenic
1108109647 13:47055092-47055114 ATTTGCAAATACCCCTGCCAAGG - Intergenic
1109978995 13:69881016-69881038 TTTTGCAAATCTCCCAGCTTGGG - Intronic
1110019182 13:70447796-70447818 ATTTGCCAATGGTTTAGCTAAGG + Intergenic
1111678160 13:91412287-91412309 ATTGGCAAATGGACTAGCAAGGG - Intronic
1112278229 13:98040181-98040203 ATTGGAAAATGCCCCATCTAGGG - Intergenic
1113757790 13:112825938-112825960 GTTTGCACATGGCCCTGCTCTGG - Intronic
1115918996 14:38351150-38351172 TTTTGGAAATAGCCAAGCTAAGG - Intergenic
1119163589 14:72473481-72473503 AATTGCAAATGGAGAAGCTATGG + Intronic
1120435534 14:84476912-84476934 TTTTGCAGATGGAACAGCTAAGG + Intergenic
1121342309 14:93112737-93112759 ATTTGAAAATGGCCCTGCTTTGG - Intronic
1121469149 14:94138632-94138654 AGTTGCAAAGGGACCAGCTGAGG - Intergenic
1122099361 14:99394879-99394901 GTCTGCAAAAGGCACAGCTAGGG - Intergenic
1124715808 15:32060650-32060672 AGTTGAAAATGTTCCAGCTATGG + Intronic
1127306291 15:57708721-57708743 ATTTGCAAATTGCCCGACAAAGG + Exonic
1129700839 15:77768013-77768035 AGTAGCAAATGGCCCAGGGAAGG + Intronic
1131770259 15:95729298-95729320 ACCTGCAAATGGGCCAGCTTAGG + Intergenic
1140818902 16:78645437-78645459 CTTTGTAAATGACCCAGCTCAGG - Intronic
1141241513 16:82269313-82269335 ATTTGCAAATGGCTAAGCATTGG + Intergenic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1143149150 17:4796613-4796635 ATTTGAAAATGGTTCAGCGACGG + Intronic
1144157061 17:12515027-12515049 ATTTGCAAATTTCCCAGCAAGGG + Intergenic
1148106775 17:45123122-45123144 ATTTGCAATTGGGCAAGCCAGGG - Intronic
1151937033 17:77268411-77268433 ATTTGCAAATTACCCAGATGTGG + Intergenic
1155943578 18:31823982-31824004 ATTTTTAAATGGCCCTGCAAAGG - Intergenic
1160065259 18:75567996-75568018 ATGAGCACATGGGCCAGCTAAGG - Intergenic
1163167846 19:15509722-15509744 ATCACCAAATGGCCCAGCTTGGG + Intronic
926476257 2:13326579-13326601 ATTATAAAATGGCACAGCTATGG - Intergenic
926525549 2:13975321-13975343 ATTTGGAAAGGGCATAGCTAGGG + Intergenic
926978878 2:18545195-18545217 CTTTGCAAATGACCAAGCCATGG - Intergenic
927336531 2:21930989-21931011 ATTCACAAATGGCCCACCCAGGG - Intergenic
928716160 2:34063252-34063274 ATTTTGAAATGGCCCTGCAAAGG - Intergenic
930386368 2:50700370-50700392 AATTGCCATTGGCCCAGCAAAGG - Intronic
930748461 2:54908695-54908717 ATCTGCACATGGCCCAGCCTCGG + Intronic
935834151 2:107031850-107031872 ATTTACAAAGGGCCAAACTATGG + Intergenic
936237333 2:110754226-110754248 ATTTAAAAATGGCCCAGGTATGG - Intronic
938960527 2:136336428-136336450 CTTTGCAAGCTGCCCAGCTAAGG - Intergenic
939184258 2:138841685-138841707 ATTTGCCAGTGGCCCATATAGGG - Intergenic
943000113 2:182316453-182316475 TTTGGTAAATGGCCCAGATAAGG + Intronic
944179421 2:196872245-196872267 ATTTGCAAATGGCCCAGCTATGG + Intronic
944527186 2:200631204-200631226 ATTTTCAAATGAGCCAGCTGAGG + Intronic
946611288 2:221460776-221460798 ATTGGCAAATGCCTCATCTAGGG - Intronic
947754989 2:232555706-232555728 GTTTGCAAATGGCACCGATACGG + Intronic
947965836 2:234280852-234280874 ATTTGGGAAGGGCTCAGCTAGGG - Intergenic
1170000391 20:11608155-11608177 TTTTGAAAATGGCCTAGATAGGG - Intergenic
1170030612 20:11940067-11940089 ATTTGCCAATGGACAAGATATGG - Intergenic
1182908238 22:33957213-33957235 ATTTGAAGATAGCCGAGCTATGG - Intergenic
1183095299 22:35548423-35548445 ATTTGCAAGTGGGCCTGCTACGG + Intronic
949336129 3:2977789-2977811 ATCTGCAAAGGGCCCAAATAAGG - Intronic
954130292 3:48557145-48557167 ATTTGCATAGGCCCCACCTACGG + Intronic
955856165 3:63276433-63276455 TTTTGCAGATAGCCCATCTAGGG - Intronic
956498181 3:69851312-69851334 ATTTGCAAATGACTGAGCCAAGG - Intronic
956731927 3:72204178-72204200 AATTGCAAATGGCCCAGCTCAGG + Intergenic
957369806 3:79278923-79278945 ATTTGCAAATGACTCATTTAAGG + Intronic
960046058 3:113199606-113199628 ATGTGCAAATGGACCAGTGAGGG + Intergenic
974904552 4:68038664-68038686 ATTTGCAAATTGCCCGACAAAGG + Intergenic
974935310 4:68404151-68404173 ATTTTGAAATGGCCCTGCAATGG + Intergenic
976383848 4:84432887-84432909 ATTTGCAAAGCACCCAACTATGG + Intergenic
977977612 4:103285764-103285786 ATTTGTAAATTGCCCAGTTGCGG + Intergenic
980086227 4:128393074-128393096 CTTTGGAAATTGTCCAGCTAAGG + Intergenic
980473705 4:133282358-133282380 ATTTGCATATGGCCTTACTAAGG - Intergenic
980963777 4:139501224-139501246 ATTTGCTAATGGCCCAGAAGAGG + Intronic
985441925 4:189988115-189988137 ATTTGAAAATGCTCTAGCTAAGG - Intergenic
986591091 5:9371623-9371645 ATTTGCAAAGGAACCAGCTAAGG - Intronic
991536309 5:67672728-67672750 ATTTATAAATGGCCCAGAAAAGG - Intergenic
993076351 5:83236801-83236823 ATTTACAAATCACCCAGCAAGGG + Intronic
993269346 5:85773817-85773839 ACTTGCAAGTGACCCAGCTGTGG - Intergenic
994115896 5:96061085-96061107 ATTTGCAGATGGGGCATCTAAGG - Intergenic
998649238 5:144099449-144099471 ATTTGCAACTGGGCCACCTGAGG - Intergenic
998784980 5:145699416-145699438 ATTTACAAATGGGCAAACTAAGG + Intronic
999971477 5:156868203-156868225 AAATGCAATTGGCCAAGCTAAGG - Intergenic
1002926011 6:1606072-1606094 ACTTGAAAATCCCCCAGCTAAGG + Intergenic
1004558299 6:16721469-16721491 ATTTGAAAATGAGCCAGCTATGG + Intronic
1004943407 6:20585549-20585571 ATTTGCATTTGGCCAAGCAAAGG - Intronic
1008426924 6:51369638-51369660 ATTAGCACATGGACCAGGTAAGG - Intergenic
1009812299 6:68683811-68683833 CTTTGCAAATGCCCCATATAAGG + Intronic
1012070329 6:94605574-94605596 TTTTGCAAATTGCCCAGTTTTGG - Intergenic
1012881571 6:104797354-104797376 AGTTGCAAATGGTCAAGTTAAGG - Intronic
1013927361 6:115489290-115489312 ATTTCCAGATGGCACTGCTAGGG - Intergenic
1014982471 6:127960674-127960696 CTTTGCAGAGGACCCAGCTAAGG - Intergenic
1015450885 6:133364897-133364919 AACTGCAACTGGCCCAGTTAGGG + Intronic
1020932160 7:14411404-14411426 AGTTGGTAATGGCCCAGATACGG + Intronic
1023492311 7:40756964-40756986 ATTTTCAAATAGACTAGCTAGGG + Intronic
1025804967 7:64822207-64822229 ATTTGCAAATTGGCCAGGCACGG - Intronic
1026148415 7:67768232-67768254 ATTTGCAAATGGCAGAGCTAGGG + Intergenic
1027587241 7:80074104-80074126 ACTCACAAATAGCCCAGCTATGG + Intergenic
1027727138 7:81821671-81821693 ATTTTCACATGGCCAAGCTTAGG - Intergenic
1027856625 7:83520073-83520095 ATTTGTCATTGGCCCTGCTAGGG + Intronic
1030891007 7:114999113-114999135 ATTTGCAAATGAAACAGGTAAGG - Intronic
1035582545 8:748661-748683 ATTTGCAAATGGCCTCACTGAGG + Intergenic
1035881587 8:3248747-3248769 GTTTGCAAAAGGCCCAGAGATGG - Intronic
1037588377 8:20293776-20293798 ATTTAAAAATGGGCCAGGTATGG + Intronic
1037843866 8:22265086-22265108 TTTTCCAAGTGGCCCAACTAAGG - Intergenic
1040418617 8:47218941-47218963 ATTAGGAAATGGCTCAGCTTGGG - Intergenic
1043391056 8:79792186-79792208 ATTTGCAAACTGCCCAACAAGGG - Intergenic
1043720029 8:83536088-83536110 ATTTGCAAATGGCTTTTCTATGG + Intergenic
1043872379 8:85448026-85448048 CTTTGCAGATGGCCAAGCTGCGG + Exonic
1044492459 8:92835576-92835598 CTTTGAAAATAGCCCAGCTTTGG + Intergenic
1049212565 8:141393425-141393447 GTTTCCAAATAGCCCCGCTAGGG + Intronic
1050971587 9:11883444-11883466 ATTTACAAATTCACCAGCTATGG - Intergenic
1050989866 9:12137100-12137122 ATTTTGAAATGGCCCTGCAAAGG + Intergenic
1051187579 9:14476193-14476215 ATTTGCAAATGACAAAGATAAGG + Intergenic
1052739720 9:32381901-32381923 TTCTGCTAATGGCCCAGCTGAGG - Intergenic
1052965467 9:34337398-34337420 ATTATCAAATGGCCCTCCTAAGG + Intronic
1053037447 9:34837409-34837431 ACTAGCAAATGACACAGCTAAGG + Intergenic
1056248526 9:84723567-84723589 ATTTGCAGATGGCAAACCTATGG - Exonic
1187483435 X:19679423-19679445 TTTTACAGATGGCCCAGCTGAGG + Intronic
1188114242 X:26223891-26223913 ATTTCCCAATGGCCAAGATAAGG + Intergenic
1188377383 X:29448712-29448734 ATTTACAGATGTCCTAGCTAGGG + Intronic
1189899639 X:45692876-45692898 ATTAGCAAATGCACCAGCTCTGG + Intergenic
1193466104 X:81849479-81849501 ATAGCCAAATGGCCCAGCTGGGG + Intergenic
1195558126 X:106250681-106250703 ATCTTCAAATAGCCCAGCAAAGG + Intergenic
1197211788 X:123834089-123834111 ATTTGGAAATGTCCAAGATAAGG + Intergenic
1197630752 X:128854894-128854916 ATTTACAAATTGCCAAGATATGG + Intergenic
1199720412 X:150539484-150539506 CTGTGCAATTGGCCAAGCTATGG - Intergenic
1200458434 Y:3422125-3422147 ATTTGCATATGACCCAGCAATGG + Intergenic