ID: 944191611

View in Genome Browser
Species Human (GRCh38)
Location 2:197009943-197009965
Sequence CAGTATGATTATATGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944191611_944191621 19 Left 944191611 2:197009943-197009965 CCCAATTCCATATAATCATACTG No data
Right 944191621 2:197009985-197010007 CCCTTTAAAAAGAAGGAAGAAGG No data
944191611_944191625 29 Left 944191611 2:197009943-197009965 CCCAATTCCATATAATCATACTG No data
Right 944191625 2:197009995-197010017 AGAAGGAAGAAGGGAGAGAAGGG No data
944191611_944191617 12 Left 944191611 2:197009943-197009965 CCCAATTCCATATAATCATACTG No data
Right 944191617 2:197009978-197010000 CTCCAACCCCTTTAAAAAGAAGG No data
944191611_944191624 28 Left 944191611 2:197009943-197009965 CCCAATTCCATATAATCATACTG No data
Right 944191624 2:197009994-197010016 AAGAAGGAAGAAGGGAGAGAAGG 0: 2
1: 30
2: 466
3: 3758
4: 18537
944191611_944191623 20 Left 944191611 2:197009943-197009965 CCCAATTCCATATAATCATACTG No data
Right 944191623 2:197009986-197010008 CCTTTAAAAAGAAGGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944191611 Original CRISPR CAGTATGATTATATGGAATT GGG (reversed) Intronic
No off target data available for this crispr