ID: 944199911

View in Genome Browser
Species Human (GRCh38)
Location 2:197095519-197095541
Sequence GGTCCTGGTGGCTGAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944199911_944199915 -5 Left 944199911 2:197095519-197095541 CCTGCACCTCAGCCACCAGGACC No data
Right 944199915 2:197095537-197095559 GGACCATAATCCTACACAAATGG No data
944199911_944199918 9 Left 944199911 2:197095519-197095541 CCTGCACCTCAGCCACCAGGACC No data
Right 944199918 2:197095551-197095573 CACAAATGGTGACTTCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944199911 Original CRISPR GGTCCTGGTGGCTGAGGTGC AGG (reversed) Intronic