ID: 944201005

View in Genome Browser
Species Human (GRCh38)
Location 2:197107390-197107412
Sequence CAGACACCAGATGCTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944201002_944201005 7 Left 944201002 2:197107360-197107382 CCTAGGGCCAATGGTGAGGTCAA No data
Right 944201005 2:197107390-197107412 CAGACACCAGATGCTGTCTTTGG No data
944201003_944201005 0 Left 944201003 2:197107367-197107389 CCAATGGTGAGGTCAAATGCCTT No data
Right 944201005 2:197107390-197107412 CAGACACCAGATGCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944201005 Original CRISPR CAGACACCAGATGCTGTCTT TGG Intronic
No off target data available for this crispr