ID: 944202314

View in Genome Browser
Species Human (GRCh38)
Location 2:197120768-197120790
Sequence GAGGTGAATGTTGAGCTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944202314_944202316 -7 Left 944202314 2:197120768-197120790 CCTATCAGCTCAACATTCACCTC No data
Right 944202316 2:197120784-197120806 TCACCTCAGTATTAGCTTCTGGG No data
944202314_944202315 -8 Left 944202314 2:197120768-197120790 CCTATCAGCTCAACATTCACCTC No data
Right 944202315 2:197120783-197120805 TTCACCTCAGTATTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944202314 Original CRISPR GAGGTGAATGTTGAGCTGAT AGG (reversed) Intronic
No off target data available for this crispr